Morpholino
MO1-gal
- ID
- ZDB-MRPHLNO-121218-3
- Name
- MO1-gal
- Previous Names
-
- MO1-galn
- Target
- Sequence
-
5' - ACTGGTAATATTCCCGCCTCTTCTG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Targets the 5'UTR.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-gal
No data available
Phenotype
Phenotype resulting from MO1-gal
| Phenotype | Fish | Figures |
|---|---|---|
| dorsal root ganglion decreased amount, abnormal | WT + MO1-gal |
Fig. 8
from Podlasz et al., 2012 |
Phenotype of all Fish created by or utilizing MO1-gal
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| dorsal root ganglion decreased amount, abnormal | WT + MO1-gal | standard conditions |
Fig. 8
from Podlasz et al., 2012 |
Citations