ZFIN ID: ZDB-MRPHLNO-121218-3
Morpholino Name: MO1-galn
Target: galn (1)
Sequence:
5' - ACTGGTAATATTCCCGCCTCTTCTG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Targets the 5'UTR.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-galn No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-galn
Expressed Gene Anatomy Figures
chata Fig. 10 from Podlasz et al., 2012
galn Fig. 6Fig. 10 from Podlasz et al., 2012
hcrt Fig. 10 from Podlasz et al., 2012
hdc Fig. 10 from Podlasz et al., 2012
th Fig. 10 from Podlasz et al., 2012
th2 Fig. 10 from Podlasz et al., 2012
tp53 Fig. 10 from Podlasz et al., 2012
PHENOTYPE
Phenotype resulting from MO1-galn
Phenotype of all Fish created by or utilizing MO1-galn
Genome Resources:
CITATIONS (1)