Morpholino
MO1-taok2a
- ID
- ZDB-MRPHLNO-121210-8
- Name
- MO1-taok2a
- Previous Names
- None
- Target
- Sequence
-
5' - TAATGGTGTGGCTTGCTCACAAAGT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-taok2a
No data available
Phenotype
Phenotype resulting from MO1-taok2a
Phenotype | Fish | Figures |
---|---|---|
brain morphology, abnormal | WT + MO1-taok2a |
Fig. 2 ![]() |
somite U-shaped, abnormal | WT + MO1-taok2a |
Fig. 3 ![]() |
1 - 2 of 2
Phenotype of all Fish created by or utilizing MO1-taok2a
Phenotype | Fish | Conditions | Figures |
---|---|---|---|
brain morphology, abnormal | WT + MO1-taok2a | standard conditions |
Fig. 2 ![]() |
somite U-shaped, abnormal | WT + MO1-taok2a | standard conditions |
Fig. 3 ![]() |
1 - 2 of 2
Citations
- McCammon, J.M., Blaker-Lee, A., Chen, X., Sive, H. (2017) The 16p11.2 homologs fam57ba and doc2a generate certain brain and body phenotypes. Human molecular genetics. 26:3699-3712
- Blaker-Lee, A., Gupta, S., McCammon, J.M., De Rienzo, G., and Sive, H. (2012) Zebrafish homologs of 16p11.2, a genomic region associated with brain disorders, are active during brain development, and include two deletion dosage sensor genes. Disease models & mechanisms. 5(6):834-851
1 - 2 of 2
Show