Morpholino

MO1-kcnh1b

ID

ZDB-MRPHLNO-121128-6

Name

MO1-kcnh1b

Previous Names

Target

Sequence

5' - GCGCTGAAGAGCCTCCTGCTACA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-kcnh1b

No data available

Phenotype

Phenotype resulting from MO1-kcnh1b

Phenotype	Fish	Figures
axis elongation disrupted, abnormal	AB/TU + MO1-kcnh1b	Fig. 6 from Stengel et al., 2012
brain hydrocephalic, abnormal	AB/TU + MO1-kcnh1b	Fig. 5 from Stengel et al., 2012
embryo development disrupted, abnormal	AB/TU + MO1-kcnh1b	Fig. 5 from Stengel et al., 2012
extension morphology, abnormal	AB/TU + MO1-kcnh1b	Fig. 5 from Stengel et al., 2012
eye immature, abnormal	AB/TU + MO1-kcnh1b	Fig. 5 from Stengel et al., 2012
heart edematous, abnormal	AB/TU + MO1-kcnh1b	Fig. 5 from Stengel et al., 2012
hindbrain development delayed, abnormal	AB/TU + MO1-kcnh1b	Fig. 6 from Stengel et al., 2012
post-vent region kinked, abnormal	AB/TU + MO1-kcnh1b	Fig. 5 from Stengel et al., 2012
rhombomere 3 decreased thickness, abnormal	AB/TU + MO1-kcnh1b	Fig. 6 from Stengel et al., 2012
rhombomere 5 decreased thickness, abnormal	AB/TU + MO1-kcnh1b	Fig. 6 from Stengel et al., 2012
somite border inconspicuous, abnormal	AB/TU + MO1-kcnh1b	Fig. 6 from Stengel et al., 2012
whole organism dead, abnormal	AB/TU + MO1-kcnh1b	Fig. 5 from Stengel et al., 2012

Phenotype of all Fish created by or utilizing MO1-kcnh1b

Phenotype	Fish	Conditions	Figures
somite border inconspicuous, abnormal	AB/TU + MO1-kcnh1b	standard conditions	Fig. 6 from Stengel et al., 2012
rhombomere 3 decreased thickness, abnormal	AB/TU + MO1-kcnh1b	standard conditions	Fig. 6 from Stengel et al., 2012
whole organism dead, abnormal	AB/TU + MO1-kcnh1b	standard conditions	Fig. 5 from Stengel et al., 2012
rhombomere 5 decreased thickness, abnormal	AB/TU + MO1-kcnh1b	standard conditions	Fig. 6 from Stengel et al., 2012
post-vent region kinked, abnormal	AB/TU + MO1-kcnh1b	standard conditions	Fig. 5 from Stengel et al., 2012
eye immature, abnormal	AB/TU + MO1-kcnh1b	standard conditions	Fig. 5 from Stengel et al., 2012
hindbrain development delayed, abnormal	AB/TU + MO1-kcnh1b	standard conditions	Fig. 6 from Stengel et al., 2012
heart edematous, abnormal	AB/TU + MO1-kcnh1b	standard conditions	Fig. 5 from Stengel et al., 2012
axis elongation disrupted, abnormal	AB/TU + MO1-kcnh1b	standard conditions	Fig. 6 from Stengel et al., 2012
extension morphology, abnormal	AB/TU + MO1-kcnh1b	standard conditions	Fig. 5 from Stengel et al., 2012
embryo development disrupted, abnormal	AB/TU + MO1-kcnh1b	standard conditions	Fig. 5 from Stengel et al., 2012
brain hydrocephalic, abnormal	AB/TU + MO1-kcnh1b	standard conditions	Fig. 5 from Stengel et al., 2012

Citations