Morpholino

MO1-mpi

ID
ZDB-MRPHLNO-121127-5
Name
MO1-mpi
Previous Names
None
Target
Sequence
5' - GAGGAAACACTTTCACTTCCGCCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-mpi
Expressed Gene Anatomy Figures
acta2 Fig. 3 from DeRossi et al., 2019
col1a1a Fig. 3 from DeRossi et al., 2019
col1a1b Fig. 3 from DeRossi et al., 2019
gfpt1 Fig. 6 with image from DeRossi et al., 2017
lamb4 Fig. 3 from DeRossi et al., 2019
pdgfba Fig. 3 from DeRossi et al., 2019
pdgfrb Fig. 3 from DeRossi et al., 2019
tgfb1a Fig. 3 from DeRossi et al., 2019
timp2b Fig. 3 from DeRossi et al., 2019
tp53 Fig. 3 with image,  Fig. 6 with image,  Fig. 7 from DeRossi et al., 2017
Phenotype
Phenotype resulting from MO1-mpi
Phenotype Fish Figures
apoptotic process increased occurrence, abnormal AB + MO1-mpi Fig. 3 with image from DeRossi et al., 2017
apoptotic process process quality, ameliorated AB + MO1-mpi + MO4-tp53 Fig. 3 with image from DeRossi et al., 2017
dolichol-linked oligosaccharide biosynthetic process disrupted, abnormal AB + MO1-mpi Fig. 2 with image from Chu et al., 2013
eye decreased size, abnormal AB + MO1-mpi Fig. 3 with image,  Fig. 6 with image from DeRossi et al., 2017
Fig. 3 with image from Chu et al., 2013
eye size, ameliorated AB + MO1-mpi + MO4-tp53 Fig. 3 with image from DeRossi et al., 2017
forebrain decreased size, abnormal AB + MO1-mpi Fig. 3 with image from Chu et al., 2013
glycolytic process decreased process quality, abnormal AB + MO1-mpi Fig. 5 from DeRossi et al., 2017
head decreased size, abnormal AB + MO1-mpi Fig. 3 with image,  Fig. 6 with image from DeRossi et al., 2017
head size, ameliorated AB + MO1-mpi + MO4-tp53 Fig. 3 with image from DeRossi et al., 2017
intrahepatic bile duct dilated, abnormal mss4Tg; um14Tg + MO1-mpi Fig. 2 from DeRossi et al., 2019
intrahepatic bile duct morphology, abnormal mss4Tg; um14Tg + MO1-mpi Fig. 2 from DeRossi et al., 2019
intrahepatic bile duct development process quality, abnormal mss4Tg; um14Tg + MO1-mpi Fig. 2 from DeRossi et al., 2019
lipooligosaccharide catabolic process increased occurrence, abnormal WT + MO1-mpi Fig. 6 from Cline et al., 2012
liver decreased size, abnormal AB + MO1-mpi Fig. 2 from DeRossi et al., 2019
Fig. 3 with image,  Fig. 6 with image from DeRossi et al., 2017
Fig. 3 with image,  Fig. 5 with image from Chu et al., 2013
liver col1a1b expression increased amount, abnormal WT + MO1-mpi Fig. 3 from DeRossi et al., 2019
liver pdgfrb expression increased amount, abnormal WT + MO1-mpi Fig. 3 from DeRossi et al., 2019
liver acta2 expression increased amount, abnormal WT + MO1-mpi Fig. 3 from DeRossi et al., 2019
liver timp2b expression increased amount, abnormal WT + MO1-mpi Fig. 3 from DeRossi et al., 2019
liver lamb4 expression increased amount, abnormal WT + MO1-mpi Fig. 3 from DeRossi et al., 2019
liver size, ameliorated AB + MO1-mpi + MO4-tp53 Fig. 3 with image from DeRossi et al., 2017
mandibular arch skeleton malformed, abnormal AB + MO1-mpi Fig. 3 with image from Chu et al., 2013
mandibular arch skeleton morphology, abnormal AB + MO1-mpi Fig. 3 with image,  Fig. 6 with image from DeRossi et al., 2017
mandibular arch skeleton morphology, ameliorated AB + MO1-mpi + MO4-tp53 Fig. 3 with image from DeRossi et al., 2017
mannose-6-phosphate isomerase activity decreased occurrence, abnormal WT + MO1-mpi Fig. 2 from DeRossi et al., 2019
oligosaccharide-lipid intermediate biosynthetic process disrupted, abnormal AB + MO1-mpi Fig. 2 with image from Chu et al., 2013
pericardium edematous, abnormal AB + MO1-mpi Fig. 3 with image,  Fig. 6 with image from DeRossi et al., 2017
Fig. 3 with image from Chu et al., 2013
pericardium edematous, ameliorated AB + MO1-mpi + MO4-tp53 Fig. 3 with image from DeRossi et al., 2017
post-vent region curved, abnormal AB + MO1-mpi Fig. 3 with image from Chu et al., 2013
whole organism tp53 expression amount, ameliorated AB + MO1-mpi + MO4-tp53 Fig. 3 with image from DeRossi et al., 2017
whole organism dead, abnormal AB + MO1-mpi Fig. 1 with image from Chu et al., 2013
whole organism decreased life span, abnormal AB + MO1-mpi Fig. 3 with image from DeRossi et al., 2017
whole organism gfpt1 expression increased amount, abnormal AB + MO1-mpi Fig. 6 with image from DeRossi et al., 2017
whole organism tp53 expression increased amount, abnormal AB + MO1-mpi Fig. 3 with image,  Fig. 6 with image,  Fig. 7 from DeRossi et al., 2017
whole organism Ab1-O-GlcNAc labeling increased amount, abnormal AB + MO1-mpi Fig. 7 from DeRossi et al., 2017
whole organism Ab2-ogt labeling increased amount, abnormal AB + MO1-mpi Fig. 7 from DeRossi et al., 2017
whole organism life span, ameliorated AB + MO1-mpi + MO4-tp53 Fig. 3 with image from DeRossi et al., 2017
whole organism lactate decreased amount, abnormal AB + MO1-mpi Fig. 5 from DeRossi et al., 2017
Phenotype of all Fish created by or utilizing MO1-mpi
Phenotype Fish Conditions Figures
whole organism Ab1-O-GlcNAc labeling amount, ameliorated AB + MO1-mpi chemical treatment: 6-diazo-5-oxo-L-norleucine Fig. 7 from DeRossi et al., 2017
whole organism tp53 expression increased amount, abnormal AB + MO1-mpi standard conditions Fig. 3 with image,  Fig. 6 with image,  Fig. 7 from DeRossi et al., 2017
glycolytic process decreased process quality, abnormal AB + MO1-mpi standard conditions Fig. 5 from DeRossi et al., 2017
whole organism dead, abnormal AB + MO1-mpi standard conditions Fig. 1 with image from Chu et al., 2013
post-vent region curved, abnormal AB + MO1-mpi standard conditions Fig. 3 with image from Chu et al., 2013
apoptotic process increased occurrence, abnormal AB + MO1-mpi standard conditions Fig. 3 with image from DeRossi et al., 2017
eye decreased size, abnormal AB + MO1-mpi control Fig. 3 with image,  Fig. 6 with image from DeRossi et al., 2017
Fig. 3 with image from Chu et al., 2013
whole organism tp53 expression amount, ameliorated AB + MO1-mpi chemical treatment: 6-diazo-5-oxo-L-norleucine Fig. 6 with image from DeRossi et al., 2017
liver decreased size, abnormal AB + MO1-mpi standard conditions Fig. 3 with image,  Fig. 6 with image from DeRossi et al., 2017
mandibular arch skeleton morphology, ameliorated AB + MO1-mpi chemical treatment: 6-diazo-5-oxo-L-norleucine Fig. 6 with image from DeRossi et al., 2017
whole organism tp53 expression amount, ameliorated AB + MO1-mpi chemical treatment: OSMI-1 Fig. 7 from DeRossi et al., 2017
whole organism gfpt1 expression increased amount, abnormal AB + MO1-mpi control Fig. 6 with image from DeRossi et al., 2017
whole organism Ab1-O-GlcNAc labeling increased amount, abnormal AB + MO1-mpi control Fig. 7 from DeRossi et al., 2017
whole organism Ab2-ogt labeling increased amount, abnormal AB + MO1-mpi control Fig. 7 from DeRossi et al., 2017
head size, ameliorated AB + MO1-mpi chemical treatment: 6-diazo-5-oxo-L-norleucine Fig. 6 with image from DeRossi et al., 2017
whole organism Ab2-ogt labeling amount, ameliorated AB + MO1-mpi chemical treatment: OSMI-1 Fig. 7 from DeRossi et al., 2017
head decreased size, abnormal AB + MO1-mpi standard conditions Fig. 3 with image,  Fig. 6 with image from DeRossi et al., 2017
mandibular arch skeleton morphology, abnormal AB + MO1-mpi standard conditions Fig. 3 with image,  Fig. 6 with image from DeRossi et al., 2017
forebrain decreased size, abnormal AB + MO1-mpi standard conditions Fig. 3 with image from Chu et al., 2013
eye size, ameliorated AB + MO1-mpi chemical treatment: 6-diazo-5-oxo-L-norleucine Fig. 6 with image from DeRossi et al., 2017
pericardium edematous, abnormal AB + MO1-mpi standard conditions Fig. 3 with image,  Fig. 6 with image from DeRossi et al., 2017
Fig. 3 with image from Chu et al., 2013
whole organism lactate decreased amount, abnormal AB + MO1-mpi standard conditions Fig. 5 from DeRossi et al., 2017
whole organism decreased life span, abnormal AB + MO1-mpi standard conditions Fig. 3 with image from DeRossi et al., 2017
oligosaccharide-lipid intermediate biosynthetic process disrupted, abnormal AB + MO1-mpi standard conditions Fig. 2 with image from Chu et al., 2013
pericardium edematous, ameliorated AB + MO1-mpi chemical treatment: 6-diazo-5-oxo-L-norleucine Fig. 6 with image from DeRossi et al., 2017
liver size, ameliorated AB + MO1-mpi chemical treatment: 6-diazo-5-oxo-L-norleucine Fig. 6 with image from DeRossi et al., 2017
mandibular arch skeleton malformed, abnormal AB + MO1-mpi standard conditions Fig. 3 with image from Chu et al., 2013
dolichol-linked oligosaccharide biosynthetic process disrupted, abnormal AB + MO1-mpi standard conditions Fig. 2 with image from Chu et al., 2013
apoptotic process process quality, ameliorated AB + MO1-mpi + MO4-tp53 standard conditions Fig. 3 with image from DeRossi et al., 2017
eye size, ameliorated AB + MO1-mpi + MO4-tp53 standard conditions Fig. 3 with image from DeRossi et al., 2017
pericardium edematous, ameliorated AB + MO1-mpi + MO4-tp53 standard conditions Fig. 3 with image from DeRossi et al., 2017
mandibular arch skeleton morphology, ameliorated AB + MO1-mpi + MO4-tp53 standard conditions Fig. 3 with image from DeRossi et al., 2017
whole organism life span, ameliorated AB + MO1-mpi + MO4-tp53 standard conditions Fig. 3 with image from DeRossi et al., 2017
head size, ameliorated AB + MO1-mpi + MO4-tp53 standard conditions Fig. 3 with image from DeRossi et al., 2017
liver size, ameliorated AB + MO1-mpi + MO4-tp53 standard conditions Fig. 3 with image from DeRossi et al., 2017
whole organism tp53 expression amount, ameliorated AB + MO1-mpi + MO4-tp53 standard conditions Fig. 3 with image from DeRossi et al., 2017
liver pdgfrb expression increased amount, abnormal WT + MO1-mpi control Fig. 3 from DeRossi et al., 2019
liver lamb4 expression increased amount, abnormal WT + MO1-mpi control Fig. 3 from DeRossi et al., 2019
liver timp2b expression increased amount, abnormal WT + MO1-mpi control Fig. 3 from DeRossi et al., 2019
liver acta2 expression increased amount, abnormal WT + MO1-mpi control Fig. 3 from DeRossi et al., 2019
liver col1a1b expression increased amount, abnormal WT + MO1-mpi control Fig. 3 from DeRossi et al., 2019
mannose-6-phosphate isomerase activity decreased occurrence, abnormal WT + MO1-mpi standard conditions Fig. 2 from DeRossi et al., 2019
lipooligosaccharide catabolic process increased occurrence, abnormal WT + MO1-mpi standard conditions Fig. 6 from Cline et al., 2012
liver size, ameliorated gz15Tg + MO1-mpi chemical treatment by environment: mannose Fig. 5 with image from Chu et al., 2013
liver decreased size, abnormal gz15Tg + MO1-mpi standard conditions Fig. 3 with image,  Fig. 5 with image from Chu et al., 2013
liver decreased size, abnormal mss4Tg + MO1-mpi standard conditions Fig. 2 from DeRossi et al., 2019
intrahepatic bile duct development process quality, abnormal mss4Tg; um14Tg + MO1-mpi standard conditions Fig. 2 from DeRossi et al., 2019
intrahepatic bile duct morphology, abnormal mss4Tg; um14Tg + MO1-mpi standard conditions Fig. 2 from DeRossi et al., 2019
intrahepatic bile duct dilated, abnormal mss4Tg; um14Tg + MO1-mpi standard conditions Fig. 2 from DeRossi et al., 2019
whole organism lactate amount, ameliorated tp53zdf1/zdf1 + MO1-mpi standard conditions Fig. 5 from DeRossi et al., 2017
eye size, ameliorated tp53zdf1/zdf1 + MO1-mpi standard conditions Fig. 3 with image from DeRossi et al., 2017
glycolytic process process quality, ameliorated tp53zdf1/zdf1 + MO1-mpi standard conditions Fig. 5 from DeRossi et al., 2017
pericardium edematous, ameliorated tp53zdf1/zdf1 + MO1-mpi standard conditions Fig. 3 with image from DeRossi et al., 2017
mandibular arch skeleton morphology, ameliorated tp53zdf1/zdf1 + MO1-mpi standard conditions Fig. 3 with image from DeRossi et al., 2017
whole organism life span, ameliorated tp53zdf1/zdf1 + MO1-mpi standard conditions Fig. 3 with image from DeRossi et al., 2017
liver size, ameliorated tp53zdf1/zdf1 + MO1-mpi standard conditions Fig. 3 with image from DeRossi et al., 2017
head size, ameliorated tp53zdf1/zdf1 + MO1-mpi standard conditions Fig. 3 with image from DeRossi et al., 2017
whole organism tp53 expression amount, ameliorated AB + MO1-gfpt1 + MO1-mpi control Fig. 6 with image from DeRossi et al., 2017
whole organism gfpt1 expression amount, ameliorated AB + MO1-gfpt1 + MO1-mpi control Fig. 6 with image from DeRossi et al., 2017
whole organism tp53 expression amount, ameliorated AB + MO1-mpi + MO1-ogt.1 standard conditions Fig. 7 from DeRossi et al., 2017
whole organism Ab1-O-GlcNAc labeling amount, ameliorated AB + MO1-mpi + MO1-ogt.1 standard conditions Fig. 7 from DeRossi et al., 2017
whole organism Ab2-ogt labeling amount, ameliorated AB + MO1-mpi + MO1-ogt.1 control Fig. 7 from DeRossi et al., 2017
thigmotaxis decreased process quality, abnormal WT + MO1-mpi + MO2-pmm2 standard conditions Fig. 8 from Cline et al., 2012
swimming behavior decreased process quality, abnormal WT + MO1-mpi + MO2-pmm2 standard conditions Fig. 8 from Cline et al., 2012
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.