Morpholino

MO1-myh9a

ID
ZDB-MRPHLNO-121120-5
Name
MO1-myh9a
Previous Names
  • zMyh9-MO (1)
Target
Sequence
5' - GAACTTCTCTGCGTCTGACATTTTG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genome Build: GRCz11Chromosome: 6
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-myh9a
Expressed Gene Anatomy Figures
myh9a Fig. 3 from Müller et al., 2011
Phenotype
Phenotype resulting from MO1-myh9a
Phenotype Fish Figures
dorsal aorta distended, abnormal WT + MO1-myh9a Fig. 4 from Müller et al., 2011
glomerular basement membrane increased thickness, abnormal AB/EKW + MO1-myh9a Fig. S3 with image,  Fig. S4 with image from Anderson et al., 2015
glomerular basement membrane podocyte foot morphology, abnormal AB/EKW + MO1-myh9a Fig. S4 with image from Anderson et al., 2015
glomerular capillary formation disrupted, abnormal WT + MO1-myh9a Fig. 4 from Müller et al., 2011
glomerular filtration decreased process quality, abnormal WT + MO1-myh9a Fig. 4 from Kotb et al., 2014
Fig. 6 from Müller et al., 2011
glomerular filtration decreased rate, abnormal WT + MO1-myh9a Fig. 4 from Kotb et al., 2014
Fig. 6 from Müller et al., 2011
glomerular filtration disrupted, abnormal AB/EKW + MO1-myh9a Fig. 5 with image,  Fig. S3 with image from Anderson et al., 2015
glomerulus morphogenesis disrupted, abnormal WT + MO1-myh9a Fig. 4 from Müller et al., 2011
heart looping disrupted, abnormal WT + MO1-myh9a text only from Müller et al., 2011
lamina densa surrounding pronephric podocyte cell projection, abnormal WT + MO1-myh9a Fig. 5 from Müller et al., 2011
pericardium edematous, abnormal WT + MO1-myh9a Fig. 2 from Müller et al., 2011
podocyte disorganized, abnormal AB/EKW + MO1-myh9a Fig. S4 with image from Anderson et al., 2015
pronephric glomerular basement membrane decreased permeability, abnormal WT + MO1-myh9a Fig. 5 from Müller et al., 2011
pronephric glomerular basement membrane increased thickness, abnormal WT + MO1-myh9a Fig. 5 from Müller et al., 2011
pronephric glomerulus morphology, abnormal WT + MO1-myh9a Fig. 3,  Fig. 4 from Müller et al., 2011
pronephric podocyte attached to dorsal aorta, abnormal WT + MO1-myh9a Fig. 4 from Müller et al., 2011
pronephric podocyte cell projection folded, abnormal WT + MO1-myh9a Fig. 5 from Müller et al., 2011
pronephric podocyte cell projection inserted into pronephric capsular space, abnormal WT + MO1-myh9a Fig. 5 from Müller et al., 2011
pronephros capillary loop nephron closure incomplete, abnormal li1Tg + MO1-myh9a Fig. 3 from Müller et al., 2011
pronephros capillary loop nephron decreased amount, abnormal WT + MO1-myh9a Fig. 4 from Müller et al., 2011
pronephros mesangial cell decreased amount, abnormal li1Tg + MO1-myh9a Fig. 3 from Müller et al., 2011
pronephros renal glomerulus malformed, abnormal WT + MO1-myh9a Fig. 4 from Müller et al., 2011
regulation of heart rate disrupted, abnormal WT + MO1-myh9a text only from Müller et al., 2011
renal glomerulus microvillus protruding into renal capsular space, abnormal AB/EKW + MO1-myh9a Fig. S3 with image from Anderson et al., 2015
whole organism curved dorsal, abnormal WT + MO1-myh9a Fig. 2 from Müller et al., 2011
whole organism edematous, abnormal AB/EKW + MO1-myh9a Fig. 5 with image,  Fig. S3 with image from Anderson et al., 2015
whole organism dorsal-ventral axis decreased length, abnormal WT + MO1-myh9a Fig. 2 from Müller et al., 2011
yolk edematous, abnormal WT + MO1-myh9a Fig. 2 from Müller et al., 2011
Phenotype of all Fish created by or utilizing MO1-myh9a
Phenotype Fish Conditions Figures
renal glomerulus microvillus protruding into renal capsular space, abnormal AB/EKW + MO1-myh9a standard conditions Fig. S3 with image from Anderson et al., 2015
glomerular basement membrane increased thickness, abnormal AB/EKW + MO1-myh9a standard conditions Fig. S3 with image,  Fig. S4 with image from Anderson et al., 2015
whole organism edematous, abnormal AB/EKW + MO1-myh9a standard conditions Fig. 5 with image,  Fig. S3 with image from Anderson et al., 2015
glomerular filtration disrupted, abnormal AB/EKW + MO1-myh9a standard conditions Fig. 5 with image,  Fig. S3 with image from Anderson et al., 2015
podocyte disorganized, abnormal AB/EKW + MO1-myh9a standard conditions Fig. S4 with image from Anderson et al., 2015
glomerular basement membrane podocyte foot morphology, abnormal AB/EKW + MO1-myh9a standard conditions Fig. S4 with image from Anderson et al., 2015
glomerulus morphogenesis disrupted, abnormal WT + MO1-myh9a standard conditions Fig. 4 from Müller et al., 2011
glomerular filtration decreased process quality, abnormal WT + MO1-myh9a standard conditions Fig. 4 from Kotb et al., 2014
Fig. 6 from Müller et al., 2011
lamina densa surrounding pronephric podocyte cell projection, abnormal WT + MO1-myh9a standard conditions Fig. 5 from Müller et al., 2011
pronephric glomerular basement membrane decreased permeability, abnormal WT + MO1-myh9a standard conditions Fig. 5 from Müller et al., 2011
pronephric podocyte cell projection inserted into pronephric capsular space, abnormal WT + MO1-myh9a standard conditions Fig. 5 from Müller et al., 2011
regulation of heart rate disrupted, abnormal WT + MO1-myh9a standard conditions text only from Müller et al., 2011
dorsal aorta distended, abnormal WT + MO1-myh9a standard conditions Fig. 4 from Müller et al., 2011
whole organism dorsal-ventral axis decreased length, abnormal WT + MO1-myh9a standard conditions Fig. 2 from Müller et al., 2011
glomerular capillary formation disrupted, abnormal WT + MO1-myh9a standard conditions Fig. 4 from Müller et al., 2011
pronephric podocyte cell projection folded, abnormal WT + MO1-myh9a standard conditions Fig. 5 from Müller et al., 2011
heart looping disrupted, abnormal WT + MO1-myh9a standard conditions text only from Müller et al., 2011
whole organism curved dorsal, abnormal WT + MO1-myh9a standard conditions Fig. 2 from Müller et al., 2011
pronephros capillary loop nephron decreased amount, abnormal WT + MO1-myh9a standard conditions Fig. 4 from Müller et al., 2011
glomerular filtration decreased rate, abnormal WT + MO1-myh9a standard conditions Fig. 4 from Kotb et al., 2014
Fig. 6 from Müller et al., 2011
pronephric glomerular basement membrane increased thickness, abnormal WT + MO1-myh9a standard conditions Fig. 5 from Müller et al., 2011
pericardium edematous, abnormal WT + MO1-myh9a standard conditions Fig. 2 from Müller et al., 2011
pronephros renal glomerulus malformed, abnormal WT + MO1-myh9a standard conditions Fig. 4 from Müller et al., 2011
yolk edematous, abnormal WT + MO1-myh9a standard conditions Fig. 2 from Müller et al., 2011
pronephric glomerulus morphology, abnormal WT + MO1-myh9a standard conditions Fig. 4 from Müller et al., 2011
pronephric podocyte attached to dorsal aorta, abnormal WT + MO1-myh9a standard conditions Fig. 4 from Müller et al., 2011
pronephros capillary loop nephron closure incomplete, abnormal li1Tg + MO1-myh9a standard conditions Fig. 3 from Müller et al., 2011
pronephric glomerulus morphology, abnormal li1Tg + MO1-myh9a standard conditions Fig. 3 from Müller et al., 2011
pronephros mesangial cell decreased amount, abnormal li1Tg + MO1-myh9a standard conditions Fig. 3 from Müller et al., 2011
whole organism edematous, abnormal AB/EKW + MO1-myh9a + MO2-apol1 standard conditions Fig. 5 with image from Anderson et al., 2015
glomerular filtration disrupted, abnormal AB/EKW + MO1-myh9a + MO2-apol1 standard conditions Fig. 5 with image from Anderson et al., 2015
glomerular filtration disrupted, abnormal AB/EKW + MO1-myh9a + MO2-apol1 chemical treatment: herbicide Fig. 5 with image from Anderson et al., 2015
glomerular filtration disrupted, abnormal AB/EKW + MO1-myh9a + MO2-apol1 + MO2-atp5if1a standard conditions Fig. 5 with image from Anderson et al., 2015
Citations
TSV
1 - 4 of 4
Show
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.