Morpholino

MO5-actn2b

ID
ZDB-MRPHLNO-121120-4
Name
MO5-actn2b
Previous Names
  • E7 MO (1)
Target
Sequence
5' - TTTATGCTTATGGTTTACCCTCTGC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO5-actn2b
No data available
Phenotype
Phenotype resulting from MO5-actn2b
Phenotype of all Fish created by or utilizing MO5-actn2b
Phenotype Fish Conditions Figures
cardiac muscle cell Z disc increased width, abnormal WT + MO5-actn2b standard conditions Fig. 4 from Yang et al., 2012
cardiac muscle cell shape, abnormal WT + MO5-actn2b standard conditions Fig. 6 from Yang et al., 2012
cardiac muscle cell Z disc shape, abnormal WT + MO5-actn2b standard conditions Fig. 4 from Yang et al., 2012
cardiac muscle cell decreased amount, abnormal WT + MO5-actn2b standard conditions Fig. 6Fig. 7 from Yang et al., 2012
cardiac muscle cell decreased size, abnormal WT + MO5-actn2b standard conditions Fig. 6Fig. 7 from Yang et al., 2012
cardiac muscle cell Z disc broken, abnormal WT + MO5-actn2b standard conditions Fig. 4 from Yang et al., 2012
ventricular myocardium decreased volume, abnormal WT + MO5-actn2b standard conditions Fig. 7 from Yang et al., 2012
pericardium edematous, abnormal WT + MO5-actn2b standard conditions Fig. 2 from Yang et al., 2012
cardiac muscle cell sarcomere disorganized, abnormal xu060Tg + MO5-actn2b chemical treatment: blebbistatin Fig. 8 from Yang et al., 2012
heart contraction arrested, abnormal xu060Tg + MO5-actn2b chemical treatment: nifedipine Fig. 8 from Yang et al., 2012
ventricular myocardium decreased size, abnormal xu060Tg + MO5-actn2b standard conditions Fig. 6 from Yang et al., 2012
cardiac muscle cell Z disc increased width, abnormal xu060Tg + MO5-actn2b chemical treatment: blebbistatin Fig. 8 from Yang et al., 2012
heart contraction arrested, abnormal xu060Tg + MO5-actn2b chemical treatment: blebbistatin Fig. 8 from Yang et al., 2012
ventricular myocardium decreased volume, abnormal xu060Tg + MO5-actn2b standard conditions Fig. 6Fig. 8 from Yang et al., 2012
cardiac muscle cell Z disc decreased length, abnormal xu060Tg + MO5-actn2b chemical treatment: blebbistatin Fig. 8 from Yang et al., 2012
ventricular myocardium cardiac chamber ballooning decreased occurrence, abnormal xu060Tg + MO5-actn2b standard conditions Fig. 6 from Yang et al., 2012
cardiac muscle cell Z disc increased width, abnormal xu060Tg + MO5-actn2b standard conditions Fig. 8 from Yang et al., 2012
cardiac muscle cell sarcomere disorganized, abnormal xu060Tg + MO5-actn2b chemical treatment: nifedipine Fig. 8 from Yang et al., 2012
cardiac muscle cell Z disc increased width, abnormal xu061Tg + MO5-actn2b standard conditions Fig. 3 from Yang et al., 2012
heart contraction process quality, abnormal xu062Tg + MO5-actn2b standard conditions Fig. 5 from Yang et al., 2012
cardiac muscle cell decreased amount, abnormal WT + MO1-tnnt2a + MO5-actn2b standard conditions Fig. 7 from Yang et al., 2012
cardiac muscle cell sarcomere disorganized, abnormal WT + MO1-tnnt2a + MO5-actn2b standard conditions Fig. 7 from Yang et al., 2012
cardiac muscle cell Z disc shape, abnormal WT + MO1-tnnt2a + MO5-actn2b standard conditions Fig. 7 from Yang et al., 2012
heart contraction arrested, abnormal WT + MO1-tnnt2a + MO5-actn2b standard conditions Fig. 7 from Yang et al., 2012
Citations