header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-121120-4
Morpholino Name: MO5-actn2b
Target: actn2b (1)
Previous Name: E7 MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TTTATGCTTATGGTTTACCCTCTGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO5-actn2b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO5-actn2b No data available
PHENOTYPE
Phenotype resulting from MO5-actn2b
Phenotype of all Fish created by or utilizing MO5-actn2b
Phenotype Fish Conditions Figures
cardiac muscle cell Z disc increased width, abnormal WT + MO5-actn2b standard conditions Fig. 4 from Yang et al., 2012
cardiac muscle cell shape, abnormal WT + MO5-actn2b standard conditions Fig. 6 from Yang et al., 2012
cardiac muscle cell Z disc shape, abnormal WT + MO5-actn2b standard conditions Fig. 4 from Yang et al., 2012
cardiac muscle cell decreased amount, abnormal WT + MO5-actn2b standard conditions Fig. 6Fig. 7 from Yang et al., 2012
cardiac muscle cell decreased size, abnormal WT + MO5-actn2b standard conditions Fig. 6Fig. 7 from Yang et al., 2012
cardiac muscle cell Z disc broken, abnormal WT + MO5-actn2b standard conditions Fig. 4 from Yang et al., 2012
ventricular myocardium decreased volume, abnormal WT + MO5-actn2b standard conditions Fig. 7 from Yang et al., 2012
pericardium edematous, abnormal WT + MO5-actn2b standard conditions Fig. 2 from Yang et al., 2012
cardiac muscle cell sarcomere disorganized, abnormal xu060Tg + MO5-actn2b chemical treatment: blebbistatin Fig. 8 from Yang et al., 2012
heart contraction arrested, abnormal xu060Tg + MO5-actn2b chemical treatment: nifedipine Fig. 8 from Yang et al., 2012
ventricular myocardium decreased size, abnormal xu060Tg + MO5-actn2b standard conditions Fig. 6 from Yang et al., 2012
cardiac muscle cell Z disc increased width, abnormal xu060Tg + MO5-actn2b chemical treatment: blebbistatin Fig. 8 from Yang et al., 2012
heart contraction arrested, abnormal xu060Tg + MO5-actn2b chemical treatment: blebbistatin Fig. 8 from Yang et al., 2012
ventricular myocardium decreased volume, abnormal xu060Tg + MO5-actn2b standard conditions Fig. 6Fig. 8 from Yang et al., 2012
cardiac muscle cell Z disc decreased length, abnormal xu060Tg + MO5-actn2b chemical treatment: blebbistatin Fig. 8 from Yang et al., 2012
ventricular myocardium cardiac chamber ballooning decreased occurrence, abnormal xu060Tg + MO5-actn2b standard conditions Fig. 6 from Yang et al., 2012
cardiac muscle cell Z disc increased width, abnormal xu060Tg + MO5-actn2b standard conditions Fig. 8 from Yang et al., 2012
cardiac muscle cell sarcomere disorganized, abnormal xu060Tg + MO5-actn2b chemical treatment: nifedipine Fig. 8 from Yang et al., 2012
cardiac muscle cell Z disc increased width, abnormal xu061Tg + MO5-actn2b standard conditions Fig. 3 from Yang et al., 2012
heart contraction process quality, abnormal xu062Tg + MO5-actn2b standard conditions Fig. 5 from Yang et al., 2012
cardiac muscle cell decreased amount, abnormal WT + MO1-tnnt2a + MO5-actn2b standard conditions Fig. 7 from Yang et al., 2012
cardiac muscle cell sarcomere disorganized, abnormal WT + MO1-tnnt2a + MO5-actn2b standard conditions Fig. 7 from Yang et al., 2012
cardiac muscle cell Z disc shape, abnormal WT + MO1-tnnt2a + MO5-actn2b standard conditions Fig. 7 from Yang et al., 2012
heart contraction arrested, abnormal WT + MO1-tnnt2a + MO5-actn2b standard conditions Fig. 7 from Yang et al., 2012
Genome Resources:
CITATIONS (1)