Morpholino

MO2-lepa

ID
ZDB-MRPHLNO-121019-3
Name
MO2-lepa
Previous Names
  • lepMO1 (1)
Target
Sequence
5' - TTGAGCGGAGAGCTGGAAAACGCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-lepa
Expressed Gene Anatomy Figures
lepa Fig. 2 from Liu et al., 2012
neurod1 Fig. 6 from Liu et al., 2012
Phenotype
Phenotype resulting from MO2-lepa
Phenotype Fish Figures
ball increased circumference, abnormal WT + MO2-lepa Fig. 3 from Liu et al., 2012
brain dorsal region physical object quality, abnormal WT + MO2-lepa Fig. 6 from Liu et al., 2012
brain development disrupted, abnormal WT + MO2-lepa Fig. 6 from Liu et al., 2012
cerebellum dorsal region morphology, abnormal WT + MO2-lepa Fig. 6 from Liu et al., 2012
cranial nerve II decreased thickness, abnormal WT + MO2-lepa Fig. 6 from Liu et al., 2012
eye decreased size, abnormal WT + MO2-lepa Fig. 3,  Fig. 4,  Fig. 5,  Fig. 6 from Liu et al., 2012
eye development disrupted, abnormal WT + MO2-lepa Fig. 5 from Liu et al., 2012
heart contraction decreased fluid flow, abnormal WT + MO2-lepa Fig. 2 with image from Dalman et al., 2013
heart contraction decreased rate, abnormal WT + MO2-lepa Fig. 2 with image from Dalman et al., 2013
heart contraction decreased volume, abnormal WT + MO2-lepa Fig. 2 with image from Dalman et al., 2013
optic tectum postero-dorsal region morphology, abnormal WT + MO2-lepa Fig. 6 from Liu et al., 2012
otic vesicle development arrested, abnormal WT + MO2-lepa text only from Liu et al., 2012
otolith decreased size, abnormal WT + MO2-lepa Fig. 5 from Liu et al., 2012
oxygen metabolic process decreased rate, abnormal WT + MO2-lepa Fig. 1 with image from Dalman et al., 2013
pericardium edematous, abnormal WT + MO2-lepa Fig. 3,  Fig. 4 from Liu et al., 2012
post-vent region kinked, abnormal WT + MO2-lepa Fig. 3,  Fig. 4 from Liu et al., 2012
retina development in camera-type eye disrupted, abnormal WT + MO2-lepa Fig. 6 from Liu et al., 2012
retinal ganglion cell layer decreased size, abnormal WT + MO2-lepa Fig. 6 from Liu et al., 2012
secondary motor neuron axon branchiness, abnormal WT + MO2-lepa Fig. 6 from Liu et al., 2012
semicircular canal hypoplastic, abnormal WT + MO2-lepa Fig. 5,  text only from Liu et al., 2012
semicircular canal development disrupted, abnormal WT + MO2-lepa Fig. 5,  text only from Liu et al., 2012
trunk kinked, abnormal WT + MO2-lepa Fig. 3,  Fig. 4 from Liu et al., 2012
whole organism decreased pigmentation, abnormal WT + MO2-lepa Fig. 3,  Fig. 4 from Liu et al., 2012
whole organism decreased size, abnormal WT + MO2-lepa Fig. 3,  Fig. 4 from Liu et al., 2012
yolk increased size, abnormal WT + MO2-lepa Fig. 3,  Fig. 4 from Liu et al., 2012
yolk present, abnormal WT + MO2-lepa Fig. 3 from Liu et al., 2012
Phenotype of all Fish created by or utilizing MO2-lepa
Phenotype Fish Conditions Figures
eye development disrupted, abnormal WT + MO2-lepa standard conditions Fig. 5 from Liu et al., 2012
ball increased circumference, abnormal WT + MO2-lepa standard conditions Fig. 3 from Liu et al., 2012
eye decreased size, abnormal WT + MO2-lepa standard conditions Fig. 3,  Fig. 4,  Fig. 5,  Fig. 6 from Liu et al., 2012
cerebellum dorsal region morphology, abnormal WT + MO2-lepa standard conditions Fig. 6 from Liu et al., 2012
optic tectum postero-dorsal region morphology, abnormal WT + MO2-lepa standard conditions Fig. 6 from Liu et al., 2012
semicircular canal hypoplastic, abnormal WT + MO2-lepa standard conditions Fig. 5,  text only from Liu et al., 2012
secondary motor neuron axon branchiness, abnormal WT + MO2-lepa standard conditions Fig. 6 from Liu et al., 2012
semicircular canal development disrupted, abnormal WT + MO2-lepa standard conditions Fig. 5,  text only from Liu et al., 2012
heart contraction decreased rate, abnormal WT + MO2-lepa standard conditions Fig. 2 with image from Dalman et al., 2013
yolk increased size, abnormal WT + MO2-lepa standard conditions Fig. 3,  Fig. 4 from Liu et al., 2012
cranial nerve II decreased thickness, abnormal WT + MO2-lepa standard conditions Fig. 6 from Liu et al., 2012
whole organism decreased pigmentation, abnormal WT + MO2-lepa standard conditions Fig. 3,  Fig. 4 from Liu et al., 2012
retina development in camera-type eye disrupted, abnormal WT + MO2-lepa standard conditions Fig. 6 from Liu et al., 2012
heart contraction decreased fluid flow, abnormal WT + MO2-lepa standard conditions Fig. 2 with image from Dalman et al., 2013
otolith decreased size, abnormal WT + MO2-lepa standard conditions Fig. 5 from Liu et al., 2012
trunk kinked, abnormal WT + MO2-lepa standard conditions Fig. 3,  Fig. 4 from Liu et al., 2012
heart contraction decreased volume, abnormal WT + MO2-lepa standard conditions Fig. 2 with image from Dalman et al., 2013
pericardium edematous, abnormal WT + MO2-lepa standard conditions Fig. 3,  Fig. 4 from Liu et al., 2012
retinal ganglion cell layer decreased size, abnormal WT + MO2-lepa standard conditions Fig. 6 from Liu et al., 2012
oxygen metabolic process decreased rate, abnormal WT + MO2-lepa standard conditions Fig. 1 with image from Dalman et al., 2013
brain development disrupted, abnormal WT + MO2-lepa standard conditions Fig. 6 from Liu et al., 2012
brain dorsal region physical object quality, abnormal WT + MO2-lepa standard conditions Fig. 6 from Liu et al., 2012
otic vesicle development arrested, abnormal WT + MO2-lepa standard conditions text only from Liu et al., 2012
whole organism decreased size, abnormal WT + MO2-lepa standard conditions Fig. 3,  Fig. 4 from Liu et al., 2012
yolk present, abnormal WT + MO2-lepa standard conditions Fig. 3 from Liu et al., 2012
post-vent region kinked, abnormal WT + MO2-lepa standard conditions Fig. 3,  Fig. 4 from Liu et al., 2012
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.