Morpholino

MO2-atg5

ID

ZDB-MRPHLNO-121017-4

Name

MO2-atg5

Previous Names

sMOatg5 (1)

Target

atg5 (1)

Sequence

5' - GTGCCCTTAAAACCAAAAATAACAC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO. The author was contacted and verified the sequence of this MO (there is an extra C).

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-atg5

Expressed Gene	Anatomy	Figures
atg5	whole organism	Fig. 4 from Hu et al., 2011
atg12	whole organism	Fig. 4 from Hu et al., 2011

Phenotype

Phenotype resulting from MO2-atg5

Phenotype	Fish	Figures
blood decreased volume, abnormal	TU + MO2-atg5	Fig. 3 from Hu et al., 2011
common cardinal vein congested, abnormal	TU + MO2-atg5	Fig. 3 from Hu et al., 2011
embryo development disrupted, abnormal	TU + MO2-atg5	Fig. 3 from Hu et al., 2011
extension decreased length, abnormal	TU + MO2-atg5	Fig. 3 from Hu et al., 2011
eye decreased size, abnormal	TU + MO2-atg5	Fig. 3 from Hu et al., 2011
eye hypoplastic, abnormal	TU + MO2-atg5	Fig. 3 from Hu et al., 2011
eye development disrupted, abnormal	TU + MO2-atg5	Fig. 3 from Hu et al., 2011
head decreased size, abnormal	TU + MO2-atg5	Fig. 3 from Hu et al., 2011
head hypoplastic, abnormal	TU + MO2-atg5	Fig. 3 from Hu et al., 2011
heart structure, abnormal	TU + MO2-atg5	Fig. 3 from Hu et al., 2011
otolith decreased amount, abnormal	TU + MO2-atg5	Fig. 3 from Hu et al., 2011
post-vent region decreased length, abnormal	TU + MO2-atg5	Fig. 3 from Hu et al., 2011
somite structure, abnormal	TU + MO2-atg5	Fig. 3 from Hu et al., 2011
trunk decreased length, abnormal	TU + MO2-atg5	Fig. 3 from Hu et al., 2011
whole organism morphology, abnormal	TU + MO2-atg5	Fig. 3 from Hu et al., 2011
whole organism viability, abnormal	TU + MO2-atg5	Fig. 3 from Hu et al., 2011
yolk vacuolated, abnormal	TU + MO2-atg5	Fig. 3 from Hu et al., 2011

Phenotype of all Fish created by or utilizing MO2-atg5

Phenotype	Fish	Conditions	Figures
eye development disrupted, abnormal	TU + MO2-atg5	standard conditions	Fig. 3 from Hu et al., 2011
post-vent region decreased length, abnormal	TU + MO2-atg5	standard conditions	Fig. 3 from Hu et al., 2011
heart structure, abnormal	TU + MO2-atg5	standard conditions	Fig. 3 from Hu et al., 2011
eye hypoplastic, abnormal	TU + MO2-atg5	standard conditions	Fig. 3 from Hu et al., 2011
head decreased size, abnormal	TU + MO2-atg5	standard conditions	Fig. 3 from Hu et al., 2011
common cardinal vein congested, abnormal	TU + MO2-atg5	standard conditions	Fig. 3 from Hu et al., 2011
whole organism morphology, abnormal	TU + MO2-atg5	standard conditions	Fig. 3 from Hu et al., 2011
head hypoplastic, abnormal	TU + MO2-atg5	standard conditions	Fig. 3 from Hu et al., 2011
otolith decreased amount, abnormal	TU + MO2-atg5	standard conditions	Fig. 3 from Hu et al., 2011
extension decreased length, abnormal	TU + MO2-atg5	standard conditions	Fig. 3 from Hu et al., 2011
somite structure, abnormal	TU + MO2-atg5	standard conditions	Fig. 3 from Hu et al., 2011
trunk decreased length, abnormal	TU + MO2-atg5	standard conditions	Fig. 3 from Hu et al., 2011
embryo development disrupted, abnormal	TU + MO2-atg5	standard conditions	Fig. 3 from Hu et al., 2011
yolk vacuolated, abnormal	TU + MO2-atg5	standard conditions	Fig. 3 from Hu et al., 2011
eye decreased size, abnormal	TU + MO2-atg5	standard conditions	Fig. 3 from Hu et al., 2011
blood decreased volume, abnormal	TU + MO2-atg5	standard conditions	Fig. 3 from Hu et al., 2011
whole organism viability, abnormal	TU + MO2-atg5	standard conditions	Fig. 3 from Hu et al., 2011

Citations