Morpholino
MO1-fshb
- ID
- ZDB-MRPHLNO-120927-3
- Name
- MO1-fshb
- Previous Names
- None
- Target
- Sequence
-
5' - AAGTAGAGGCTAGAAGAGCACCATT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-fshb
No data available
Phenotype
Phenotype resulting from MO1-fshb
| Phenotype | Fish | Figures |
|---|---|---|
| eye decreased size, abnormal | WT + MO1-fshb |
Fig. 3
from Chen et al., 2012 |
| heart edematous, abnormal | WT + MO1-fshb |
Fig. 3
from Chen et al., 2012 |
| spinal cord curved, abnormal | WT + MO1-fshb |
Fig. 3
from Chen et al., 2012 |
Phenotype of all Fish created by or utilizing MO1-fshb
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| heart edematous, abnormal | WT + MO1-fshb | standard conditions |
Fig. 3
from Chen et al., 2012 |
| eye decreased size, abnormal | WT + MO1-fshb | standard conditions |
Fig. 3
from Chen et al., 2012 |
| spinal cord curved, abnormal | WT + MO1-fshb | standard conditions |
Fig. 3
from Chen et al., 2012 |
Citations