Community Action Needed: Please respond to the NIH RFI
Morpholino

MO4-gata1a

ID
ZDB-MRPHLNO-120829-1
Name
MO4-gata1a
Previous Names
  • translation-blocking gata1 MO (1)
Target
Sequence
5' - TTCTCCATCTGCAAGTGTAGTATTG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-gata1a
No data available
Phenotype
Phenotype resulting from MO4-gata1a
No data available
Phenotype of all Fish created by or utilizing MO4-gata1a
No data available
Citations