Morpholino
MO1-git1
- ID
- ZDB-MRPHLNO-120823-9
- Name
- MO1-git1
- Previous Names
-
- Git1 ATG (1)
- Target
- Sequence
-
5' - CGCTTCTCTGGACTTTCCTGGACAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-git1
No data available
Phenotype
Phenotype resulting from MO1-git1
| Phenotype | Fish | Figures |
|---|---|---|
| brain hemorrhagic, abnormal | TL + MO1-git1 |
Fig. 1 |
| brain hydrocephalic, abnormal | TL + MO1-git1 |
Fig. 1 |
| brain vasculature broken, abnormal | TL + MO1-git1 |
Fig. 1 |
Phenotype of all Fish created by or utilizing MO1-git1
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| brain vasculature broken, abnormal | TL + MO1-git1 | standard conditions |
Fig. 1 |
| brain hemorrhagic, abnormal | TL + MO1-git1 | standard conditions |
Fig. 1 |
| brain hydrocephalic, abnormal | TL + MO1-git1 | standard conditions |
Fig. 1 |
Citations