Morpholino

MO1-upk3b

ID
ZDB-MRPHLNO-120816-4
Name
MO1-upk3b
Previous Names
  • MO1-upk3l
Target
Sequence
5' - AACGGATCGCATTGTGTGTGTTCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-upk3b
Expressed Gene Anatomy Figures
cdh17 Fig. 4 with image from Mitra et al., 2012
clcnk Fig. 4 with image from Mitra et al., 2012
nphs2 Fig. 4 with image from Mitra et al., 2012
pax2a Fig. 4 with image from Mitra et al., 2012
slc4a4a Fig. 4 with image from Mitra et al., 2012
slc12a1 Fig. 4 with image from Mitra et al., 2012
wt1a Fig. 4 with image from Mitra et al., 2012
Phenotype
Phenotype resulting from MO1-upk3b
Phenotype Fish Figures
blood circulation decreased occurrence, abnormal y1Tg + MO1-upk3b Fig. 2 with image,  Fig. 3 with image from Mitra et al., 2012
caudal fin curvature, abnormal WT + MO1-upk3b Fig. 2 with image from Mitra et al., 2012
eye morphology, abnormal WT + MO1-upk3b Fig. 2 with image from Mitra et al., 2012
head morphology, abnormal WT + MO1-upk3b Fig. 2 with image from Mitra et al., 2012
pericardium edematous, abnormal y1Tg + MO1-upk3b Fig. 2 with image,  Fig. 3 with image from Mitra et al., 2012
pronephric duct cilium kinked, abnormal WT + MO1-upk3b Fig. 5 with image from Mitra et al., 2012
pronephric duct cilium shortened, abnormal WT + MO1-upk3b Fig. 5 with image from Mitra et al., 2012
pronephric duct epithelial cell lacks parts or has fewer parts of type epithelial cell microvillus, abnormal WT + MO1-upk3b Fig. 5 with image from Mitra et al., 2012
renal filtration decreased process quality, abnormal y1Tg + MO1-upk3b Fig. 3 with image from Mitra et al., 2012
Phenotype of all Fish created by or utilizing MO1-upk3b
Phenotype Fish Conditions Figures
pronephric duct epithelial cell lacks parts or has fewer parts of type epithelial cell microvillus, abnormal WT + MO1-upk3b standard conditions Fig. 5 with image from Mitra et al., 2012
caudal fin curvature, abnormal WT + MO1-upk3b standard conditions Fig. 2 with image from Mitra et al., 2012
renal filtration decreased process quality, abnormal WT + MO1-upk3b standard conditions Fig. 3 with image from Mitra et al., 2012
pericardium edematous, abnormal WT + MO1-upk3b standard conditions Fig. 2 with image,  Fig. 3 with image from Mitra et al., 2012
eye morphology, abnormal WT + MO1-upk3b standard conditions Fig. 2 with image from Mitra et al., 2012
blood circulation decreased occurrence, abnormal WT + MO1-upk3b standard conditions Fig. 2 with image from Mitra et al., 2012
head morphology, abnormal WT + MO1-upk3b standard conditions Fig. 2 with image from Mitra et al., 2012
pronephric duct cilium kinked, abnormal WT + MO1-upk3b standard conditions Fig. 5 with image from Mitra et al., 2012
pronephric duct cilium shortened, abnormal WT + MO1-upk3b standard conditions Fig. 5 with image from Mitra et al., 2012
blood circulation decreased occurrence, abnormal y1Tg + MO1-upk3b standard conditions Fig. 3 with image from Mitra et al., 2012
pericardium edematous, abnormal y1Tg + MO1-upk3b standard conditions Fig. 3 with image from Mitra et al., 2012
renal filtration decreased process quality, abnormal y1Tg + MO1-upk3b standard conditions Fig. 3 with image from Mitra et al., 2012
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.