Morpholino

MO1-ccsapb

ID

ZDB-MRPHLNO-120611-2

Name

MO1-ccsapb

Previous Names

MO1-csap
MO1-csapb

Target

ccsapb (1)

Sequence

5' - TTGGAAATCACCCCGACTCACCTCT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-ccsapb

No data available

Phenotype

Phenotype resulting from MO1-ccsapb

Phenotype	Fish	Figures
axonal fasciculation disrupted, abnormal	AB + MO1-ccsapb + MO4-tp53	Fig. 5 from Backer et al., 2012
brain decreased object quality, abnormal	AB + MO1-ccsapb + MO4-tp53	Fig. 4 from Backer et al., 2012
brain development disrupted, abnormal	AB + MO1-ccsapb + MO4-tp53	Fig. 4 from Backer et al., 2012
central nervous system projection neuron axonogenesis disrupted, abnormal	AB + MO1-ccsapb + MO4-tp53	Fig. 5 from Backer et al., 2012
cilium movement arrested, abnormal	hsc5Tg + MO1-ccsapb + MO4-tp53	Fig. 6 from Backer et al., 2012
determination of heart left/right asymmetry disrupted, abnormal	AB + MO1-ccsapb + MO4-tp53	Fig. 6 from Backer et al., 2012
eye decreased size, abnormal	AB + MO1-ccsapb + MO4-tp53	Fig. 4 from Backer et al., 2012
heart displaced to whole organism medial side, abnormal	AB + MO1-ccsapb + MO4-tp53	Fig. 6 from Backer et al., 2012
heart displaced to whole organism right side, abnormal	AB + MO1-ccsapb + MO4-tp53	Fig. 6 from Backer et al., 2012
heart edematous, abnormal	AB + MO1-ccsapb + MO4-tp53	Fig. 4 from Backer et al., 2012
hindbrain neuroepithelial cell decreased amount, abnormal	AB + MO1-ccsapb + MO4-tp53	Fig. 5 from Backer et al., 2012
induction of programmed cell death increased occurrence, abnormal	AB + MO1-ccsapb + MO4-tp53	Fig. 5 from Backer et al., 2012
Mauthner neuron decreased amount, abnormal	AB + MO1-ccsapb + MO4-tp53	Fig. 5 from Backer et al., 2012
somite border disorganized, abnormal	AB + MO1-ccsapb + MO4-tp53	Fig. 4 from Backer et al., 2012
thigmotaxis disrupted, abnormal	AB + MO1-ccsapb + MO4-tp53	Fig. 4 from Backer et al., 2012
ventricular zone cell apoptotic, abnormal	AB + MO1-ccsapb + MO4-tp53	Fig. 4 from Backer et al., 2012

Phenotype of all Fish created by or utilizing MO1-ccsapb

Phenotype	Fish	Conditions	Figures
somite border disorganized, abnormal	AB + MO1-ccsapb + MO4-tp53	standard conditions	Fig. 4 from Backer et al., 2012
induction of programmed cell death increased occurrence, abnormal	AB + MO1-ccsapb + MO4-tp53	standard conditions	Fig. 5 from Backer et al., 2012
eye decreased size, abnormal	AB + MO1-ccsapb + MO4-tp53	standard conditions	Fig. 4 from Backer et al., 2012
thigmotaxis disrupted, abnormal	AB + MO1-ccsapb + MO4-tp53	standard conditions	Fig. 4 from Backer et al., 2012
heart edematous, abnormal	AB + MO1-ccsapb + MO4-tp53	standard conditions	Fig. 4 from Backer et al., 2012
heart displaced to whole organism right side, abnormal	AB + MO1-ccsapb + MO4-tp53	standard conditions	Fig. 6 from Backer et al., 2012
brain decreased object quality, abnormal	AB + MO1-ccsapb + MO4-tp53	standard conditions	Fig. 4 from Backer et al., 2012
heart displaced to whole organism medial side, abnormal	AB + MO1-ccsapb + MO4-tp53	standard conditions	Fig. 6 from Backer et al., 2012
hindbrain neuroepithelial cell decreased amount, abnormal	AB + MO1-ccsapb + MO4-tp53	standard conditions	Fig. 5 from Backer et al., 2012
brain development disrupted, abnormal	AB + MO1-ccsapb + MO4-tp53	standard conditions	Fig. 4 from Backer et al., 2012
central nervous system projection neuron axonogenesis disrupted, abnormal	AB + MO1-ccsapb + MO4-tp53	standard conditions	Fig. 5 from Backer et al., 2012
ventricular zone cell apoptotic, abnormal	AB + MO1-ccsapb + MO4-tp53	standard conditions	Fig. 4 from Backer et al., 2012
axonal fasciculation disrupted, abnormal	AB + MO1-ccsapb + MO4-tp53	standard conditions	Fig. 5 from Backer et al., 2012
determination of heart left/right asymmetry disrupted, abnormal	AB + MO1-ccsapb + MO4-tp53	standard conditions	Fig. 6 from Backer et al., 2012
Mauthner neuron decreased amount, abnormal	AB + MO1-ccsapb + MO4-tp53	standard conditions	Fig. 5 from Backer et al., 2012
cilium movement arrested, abnormal	hsc5Tg + MO1-ccsapb + MO4-tp53	standard conditions	Fig. 6 from Backer et al., 2012

Citations