Morpholino
MO4-ntn1a
- ID
- ZDB-MRPHLNO-120604-2
- Name
- MO4-ntn1a
- Previous Names
- None
- Target
- Sequence
-
5' - CCAAAGCATCAGAGACTCTCAACAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-ntn1a
No data available
Phenotype
Phenotype resulting from MO4-ntn1a
1 - 5 of 7 Show all
Phenotype of all Fish created by or utilizing MO4-ntn1a
1 - 5 of 22 Show all
Citations
- Tu, T., Zhang, C., Yan, H., Luo, Y., Kong, R., Wen, P., Ye, Z., Chen, J., Feng, J., Liu, F., Wu, J.Y., Yan, X. (2015) CD146 acts as a novel receptor for netrin-1 in promoting angiogenesis and vascular development. Cell Research. 25(3):275-87
- Gao, J., Zhang, C., Yang, B., Sun, L., Zhang, C., Westerfield, M., and Peng, G. (2012) Dcc Regulates Asymmetric Outgrowth of Forebrain Neurons in Zebrafish. PLoS One. 7(5):e36516
- Zhang, C., Gao, J., Zhang, H., Sun, L., and Peng, G. (2012) Robo2-Slit and Dcc-Netrin1 Coordinate Neuron Axonal Pathfinding within the Embryonic Axon Tracts. The Journal of neuroscience : the official journal of the Society for Neuroscience. 32(36):12589-12602
1 - 3 of 3
Show