Morpholino

MO1-piezo1

ID

ZDB-MRPHLNO-120507-2

Name

MO1-piezo1

Previous Names

FAM38A 5 prime UTR MO (1)
MO1-im:7149048

Target

piezo1 (1)

Sequence

5' - GAGCGACACTTCCACTCACATTCCT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-piezo1

No data available

Phenotype

Phenotype resulting from MO1-piezo1

Phenotype	Fish	Figures
epidermis mitotic cell cycle decreased rate, abnormal	AB + MO1-piezo1	Fig. S4 from Gudipaty et al., 2017
head increased accumulation epidermal cell, abnormal	s1999tTg; zc1044aEt + MO1-piezo1	Fig. S10 from Eisenhoffer et al., 2012
homeostasis of number of cells within a tissue disrupted, abnormal	WT + MO1-piezo1	Fig. 4, Fig. S8, Fig. S9, Fig. S10 from Eisenhoffer et al., 2012
integument increased accumulation epidermal cell, abnormal	WT + MO1-piezo1	Fig. S8, Fig. S9 from Eisenhoffer et al., 2012
keratin accumulating cell increased accumulation epidermis, abnormal	s1999tTg; zc1044aEt + MO1-piezo1	Fig. S9, Fig. S10 from Eisenhoffer et al., 2012
ventral fin fold increased accumulation epidermal cell, abnormal	s1999tTg; zc1044aEt + MO1-piezo1	Fig. 4, Fig. S9, Fig. S10 from Eisenhoffer et al., 2012
whole organism dead, abnormal	WT + MO1-piezo1	Fig. S8 from Eisenhoffer et al., 2012
whole organism monstrous, abnormal	WT + MO1-piezo1	Fig. S8, Fig. S9 from Eisenhoffer et al., 2012

Phenotype of all Fish created by or utilizing MO1-piezo1

Phenotype	Fish	Conditions	Figures
epidermis mitotic cell cycle decreased rate, abnormal	AB + MO1-piezo1	standard conditions	Fig. S4 from Gudipaty et al., 2017
whole organism monstrous, abnormal	WT + MO1-piezo1	standard conditions	Fig. S8, Fig. S9 from Eisenhoffer et al., 2012
ventral fin fold increased accumulation epidermal cell, abnormal	WT + MO1-piezo1	generic control	Fig. S9 from Eisenhoffer et al., 2012
whole organism dead, abnormal	WT + MO1-piezo1	standard conditions	Fig. S8 from Eisenhoffer et al., 2012
homeostasis of number of cells within a tissue disrupted, abnormal	WT + MO1-piezo1	standard conditions	Fig. S8, Fig. S9 from Eisenhoffer et al., 2012
integument increased accumulation epidermal cell, abnormal	WT + MO1-piezo1	standard conditions	Fig. S8, Fig. S9 from Eisenhoffer et al., 2012
keratin accumulating cell increased accumulation epidermis, abnormal	gz7Tg + MO1-piezo1	generic control	Fig. S9 from Eisenhoffer et al., 2012
homeostasis of number of cells within a tissue disrupted, abnormal	gz7Tg + MO1-piezo1	generic control	Fig. S9 from Eisenhoffer et al., 2012
homeostasis of number of cells within a tissue disrupted, abnormal	zf106Tg + MO1-piezo1	standard conditions	Fig. 4 from Eisenhoffer et al., 2012
ventral fin fold increased accumulation epidermal cell, abnormal	zf106Tg + MO1-piezo1	standard conditions	Fig. 4 from Eisenhoffer et al., 2012
head increased accumulation epidermal cell, abnormal	s1999tTg; zc1044aEt + MO1-piezo1	generic control	Fig. S10 from Eisenhoffer et al., 2012
ventral fin fold increased accumulation epidermal cell, abnormal	s1999tTg; zc1044aEt + MO1-piezo1	generic control	Fig. S10 from Eisenhoffer et al., 2012
keratin accumulating cell increased accumulation epidermis, abnormal	s1999tTg; zc1044aEt + MO1-piezo1	generic control	Fig. S10 from Eisenhoffer et al., 2012
homeostasis of number of cells within a tissue disrupted, abnormal	s1999tTg; zc1044aEt + MO1-piezo1	generic control	Fig. S10 from Eisenhoffer et al., 2012

Citations