Morpholino

MO1-kank3

ID
ZDB-MRPHLNO-120425-1
Name
MO1-kank3
Previous Names
  • NBP MO (1)
Target
Sequence
5' - TGCACAGATTGGGTCATTTTATGTA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-kank3
No data available
Phenotype
Phenotype resulting from MO1-kank3
Phenotype of all Fish created by or utilizing MO1-kank3
Phenotype Fish Conditions Figures
epidermal cell increased variability of size, abnormal WT + MO1-kank3 standard conditions Fig. 3 with image from Boggetti et al., 2012
neural tube malformed, abnormal WT + MO1-kank3 standard conditions Fig. 4 with image from Boggetti et al., 2012
neural tube formation decreased process quality, abnormal WT + MO1-kank3 standard conditions Fig. 4 with image from Boggetti et al., 2012
neural tube cell disorganized, abnormal WT + MO1-kank3 standard conditions Fig. 4 with image from Boggetti et al., 2012
epidermis morphogenesis decreased process quality, abnormal WT + MO1-kank3 standard conditions Fig. 3 with image from Boggetti et al., 2012
chordate embryonic development delayed, abnormal WT + MO1-kank3 standard conditions Fig. 3 with image from Boggetti et al., 2012
somitogenesis decreased process quality, abnormal WT + MO1-kank3 standard conditions Fig. 5 with image from Boggetti et al., 2012
epidermis epidermal cell separated from epidermis epidermal cell, abnormal WT + MO1-kank3 standard conditions Fig. 3 with image from Boggetti et al., 2012
convergent extension involved in gastrulation decreased process quality, abnormal WT + MO1-kank3 standard conditions Fig. 5 with image from Boggetti et al., 2012
cell-cell adhesion decreased process quality, abnormal WT + MO1-kank3 standard conditions Fig. 3 with image from Boggetti et al., 2012
neural tube has extra parts of type central canal, abnormal WT + MO1-kank3 standard conditions Fig. 4 with image from Boggetti et al., 2012
whole organism malformed, abnormal WT + MO1-kank3 standard conditions Fig. 3 with image from Boggetti et al., 2012
hindbrain apoptotic, abnormal WT + MO1-kank3 standard conditions Fig. 4 with image from Boggetti et al., 2012
neural tube cell disorganized, abnormal WT + MO1-kank3 + MO3-numb standard conditions Fig. 4 with image from Boggetti et al., 2012
neural tube formation decreased process quality, abnormal WT + MO1-kank3 + MO3-numb standard conditions Fig. 4 with image from Boggetti et al., 2012
neural tube malformed, abnormal WT + MO1-kank3 + MO3-numb standard conditions Fig. 4 with image from Boggetti et al., 2012
neural tube has extra parts of type central canal, abnormal WT + MO1-kank3 + MO3-numb standard conditions Fig. 4 with image from Boggetti et al., 2012
Citations