Morpholino

MO2-pls3

ID
ZDB-MRPHLNO-120424-8
Name
MO2-pls3
Previous Names
None
Target
Sequence
5' - ATATCTTACCAGCCATCTCCCAAAG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-pls3
Expressed Gene Anatomy Figures
slc12a3 Fig. 3 from Fédou et al., 2021
slc20a1a Fig. 3 from Fédou et al., 2021
wt1a Fig. 3 from Fédou et al., 2021
Phenotype
Phenotype resulting from MO2-pls3
Phenotype Fish Figures
bone mineralization disrupted, abnormal zf195Tg + MO2-pls3 Fig. S9 from van Dijk et al., 2013
ceratobranchial cartilage absence of anatomical entity, abnormal zf195Tg + MO2-pls3 Fig. 1 with image from Zhong et al., 2024
ceratobranchial cartilage absent, abnormal zf195Tg + MO2-pls3 Fig. S8 from van Dijk et al., 2013
ceratobranchial cartilage EGFP expression spatial pattern, abnormal zf195Tg + MO2-pls3 Fig. 1 with image from Zhong et al., 2024
ceratohyal cartilage decreased length, abnormal zf195Tg + MO2-pls3 Fig. 1 with image from Zhong et al., 2024
ceratohyal cartilage deformed, abnormal zf195Tg + MO2-pls3 Fig. 1 with image from Zhong et al., 2024
ceratohyal cartilage malformed, abnormal zf195Tg + MO2-pls3 Fig. S7,  Fig. S8 from van Dijk et al., 2013
ceratohyal cartilage EGFP expression spatial pattern, abnormal zf195Tg + MO2-pls3 Fig. 1 with image from Zhong et al., 2024
cranium malformed, abnormal zf195Tg + MO2-pls3 Fig. S7,  Fig. S8 from van Dijk et al., 2013
embryonic cranial skeleton morphogenesis disrupted, abnormal zf195Tg + MO2-pls3 Fig. S7,  Fig. S8 from van Dijk et al., 2013
embryonic neurocranium morphogenesis disrupted, abnormal zf195Tg + MO2-pls3 Fig. S7,  Fig. S8 from van Dijk et al., 2013
heart edematous, abnormal zf195Tg + MO2-pls3 Fig. S9 from van Dijk et al., 2013
Meckel's cartilage decreased length, abnormal zf195Tg + MO2-pls3 Fig. 1 with image from Zhong et al., 2024
Meckel's cartilage deformed, abnormal zf195Tg + MO2-pls3 Fig. 1 with image from Zhong et al., 2024
Meckel's cartilage malformed, abnormal zf195Tg + MO2-pls3 Fig. S7,  Fig. S8 from van Dijk et al., 2013
Meckel's cartilage EGFP expression spatial pattern, abnormal zf195Tg + MO2-pls3 Fig. 1 with image from Zhong et al., 2024
motor neuron axon branchiness, abnormal os26Tg + MO2-pls3 Fig. 7 from Hao et al., 2012
motor neuron growth cone increased size, abnormal os26Tg + MO2-pls3 Fig. 7 from Hao et al., 2012
muscle deformed, abnormal zf195Tg + MO2-pls3 Fig. S8 from van Dijk et al., 2013
opercular flap mineralized, abnormal zf195Tg + MO2-pls3 Fig. S9 from van Dijk et al., 2013
palatoquadrate cartilage decreased length, abnormal zf195Tg + MO2-pls3 Fig. 1 with image from Zhong et al., 2024
palatoquadrate cartilage deformed, abnormal zf195Tg + MO2-pls3 Fig. 1 with image from Zhong et al., 2024
palatoquadrate cartilage malformed, abnormal zf195Tg + MO2-pls3 Fig. S7,  Fig. S8 from van Dijk et al., 2013
palatoquadrate cartilage EGFP expression spatial pattern, abnormal zf195Tg + MO2-pls3 Fig. 1 with image from Zhong et al., 2024
post-vent region curved, abnormal zf195Tg + MO2-pls3 Fig. 1 with image from Zhong et al., 2024
Fig. S7,  Fig. S8 from van Dijk et al., 2013
post-vent region decreased size, abnormal zf195Tg + MO2-pls3 Fig. S7,  Fig. S8 from van Dijk et al., 2013
pronephric distal early tubule slc12a3 expression spatial pattern, abnormal WT + MO2-pls3 Fig. 3 from Fédou et al., 2021
pronephric glomerulus pronephric podocyte wt1a expression spatial pattern, abnormal WT + MO2-pls3 Fig. 3 from Fédou et al., 2021
pronephric proximal convoluted tubule slc20a1a expression spatial pattern, abnormal WT + MO2-pls3 Fig. 3 from Fédou et al., 2021
trunk bent, abnormal zf195Tg + MO2-pls3 Fig. 1 with image from Zhong et al., 2024
trunk anatomical axis bent, abnormal zf195Tg + MO2-pls3 Fig. S7,  Fig. S8 from van Dijk et al., 2013
whole organism decreased length, abnormal WT + MO2-pls3 Fig. 3 from Fédou et al., 2021
whole organism anterior-posterior axis decreased length, abnormal zf195Tg + MO2-pls3 Fig. S7,  Fig. S8 from van Dijk et al., 2013
Phenotype of all Fish created by or utilizing MO2-pls3
Phenotype Fish Conditions Figures
whole organism decreased length, abnormal WT + MO2-pls3 control Fig. 3 from Fédou et al., 2021
pronephric glomerulus pronephric podocyte wt1a expression spatial pattern, abnormal WT + MO2-pls3 control Fig. 3 from Fédou et al., 2021
heart edematous, abnormal WT + MO2-pls3 standard conditions Fig. S9 from van Dijk et al., 2013
pronephric distal early tubule slc12a3 expression spatial pattern, abnormal WT + MO2-pls3 control Fig. 3 from Fédou et al., 2021
pronephric proximal convoluted tubule slc20a1a expression spatial pattern, abnormal WT + MO2-pls3 control Fig. 3 from Fédou et al., 2021
motor neuron axon branchiness, abnormal os26Tg + MO2-pls3 standard conditions Fig. 7 from Hao et al., 2012
motor neuron growth cone increased size, abnormal os26Tg + MO2-pls3 standard conditions Fig. 7 from Hao et al., 2012
Meckel's cartilage decreased length, abnormal zf195Tg + MO2-pls3 control Fig. 1 with image from Zhong et al., 2024
whole organism anterior-posterior axis decreased length, abnormal zf195Tg + MO2-pls3 standard conditions Fig. S7,  Fig. S8 from van Dijk et al., 2013
ceratohyal cartilage deformed, abnormal zf195Tg + MO2-pls3 control Fig. 1 with image from Zhong et al., 2024
ceratobranchial cartilage absence of anatomical entity, abnormal zf195Tg + MO2-pls3 control Fig. 1 with image from Zhong et al., 2024
palatoquadrate cartilage decreased length, abnormal zf195Tg + MO2-pls3 control Fig. 1 with image from Zhong et al., 2024
ceratobranchial cartilage absent, abnormal zf195Tg + MO2-pls3 standard conditions Fig. S8 from van Dijk et al., 2013
embryonic cranial skeleton morphogenesis disrupted, abnormal zf195Tg + MO2-pls3 standard conditions Fig. S7,  Fig. S8 from van Dijk et al., 2013
embryonic neurocranium morphogenesis disrupted, abnormal zf195Tg + MO2-pls3 standard conditions Fig. S7,  Fig. S8 from van Dijk et al., 2013
palatoquadrate cartilage deformed, abnormal zf195Tg + MO2-pls3 control Fig. 1 with image from Zhong et al., 2024
Meckel's cartilage deformed, abnormal zf195Tg + MO2-pls3 control Fig. 1 with image from Zhong et al., 2024
heart edematous, abnormal zf195Tg + MO2-pls3 standard conditions Fig. S9 from van Dijk et al., 2013
ceratohyal cartilage decreased length, abnormal zf195Tg + MO2-pls3 control Fig. 1 with image from Zhong et al., 2024
opercular flap mineralized, abnormal zf195Tg + MO2-pls3 standard conditions Fig. S9 from van Dijk et al., 2013
palatoquadrate cartilage malformed, abnormal zf195Tg + MO2-pls3 standard conditions Fig. S7,  Fig. S8 from van Dijk et al., 2013
bone mineralization disrupted, abnormal zf195Tg + MO2-pls3 standard conditions Fig. S9 from van Dijk et al., 2013
ceratohyal cartilage EGFP expression spatial pattern, abnormal zf195Tg + MO2-pls3 control Fig. 1 with image from Zhong et al., 2024
muscle deformed, abnormal zf195Tg + MO2-pls3 standard conditions Fig. S8 from van Dijk et al., 2013
post-vent region decreased size, abnormal zf195Tg + MO2-pls3 standard conditions Fig. S7,  Fig. S8 from van Dijk et al., 2013
palatoquadrate cartilage EGFP expression spatial pattern, abnormal zf195Tg + MO2-pls3 control Fig. 1 with image from Zhong et al., 2024
trunk anatomical axis bent, abnormal zf195Tg + MO2-pls3 standard conditions Fig. S7,  Fig. S8 from van Dijk et al., 2013
ceratohyal cartilage malformed, abnormal zf195Tg + MO2-pls3 standard conditions Fig. S7,  Fig. S8 from van Dijk et al., 2013
cranium malformed, abnormal zf195Tg + MO2-pls3 standard conditions Fig. S7,  Fig. S8 from van Dijk et al., 2013
trunk bent, abnormal zf195Tg + MO2-pls3 control Fig. 1 with image from Zhong et al., 2024
post-vent region curved, abnormal zf195Tg + MO2-pls3 standard conditions Fig. 1 with image from Zhong et al., 2024
Fig. S7,  Fig. S8 from van Dijk et al., 2013
ceratobranchial cartilage EGFP expression spatial pattern, abnormal zf195Tg + MO2-pls3 control Fig. 1 with image from Zhong et al., 2024
Meckel's cartilage EGFP expression spatial pattern, abnormal zf195Tg + MO2-pls3 control Fig. 1 with image from Zhong et al., 2024
Meckel's cartilage malformed, abnormal zf195Tg + MO2-pls3 standard conditions Fig. S7,  Fig. S8 from van Dijk et al., 2013
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.