Morpholino

MO2-ocrl

ID
ZDB-MRPHLNO-120409-1
Name
MO2-ocrl
Previous Names
  • OCRL MO1 (1)
Target
Sequence
5' - CGGAAATCCCAAATGAAGGTTCCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-ocrl
Expressed Gene Anatomy Figures
ocrl Fig. S5 from Luo et al., 2012
Phenotype
Phenotype resulting from MO2-ocrl
Phenotype Fish Figures
brain hydrocephalic, abnormal WT + MO2-ocrl Fig. 2 from Rbaibi et al., 2012
cellular response to epinephrine stimulus delayed, abnormal WT + MO2-ocrl Fig. 4 with image from Luo et al., 2013
embryo development disrupted, abnormal WT + MO2-ocrl Fig. 2 from Rbaibi et al., 2012
eye decreased size, abnormal AB/TU + MO2-ocrl Fig. S1 from Coon et al., 2012
Fig. 5,  Fig. S5 from Luo et al., 2012
head decreased size, abnormal AB/TL + MO2-ocrl Fig. S1 from Coon et al., 2012
Kupffer's vesicle has fewer parts of type ciliated epithelial cell cilium, abnormal AB/TU + MO2-ocrl Fig. 5 from Luo et al., 2012
Kupffer's vesicle cilium decreased length, abnormal WT + MO2-ocrl Fig. 7 with image from Luo et al., 2013
Fig. S5 from Luo et al., 2012
lens decreased size, abnormal AB/TU + MO2-ocrl Fig. 5,  Fig. S5 from Luo et al., 2012
melanocyte decreased amount, abnormal AB/TL + MO2-ocrl Fig. S1 from Coon et al., 2012
melanocyte mislocalised, abnormal AB/TL + MO2-ocrl Fig. S1 from Coon et al., 2012
melanocyte melanosome spatial pattern, abnormal WT + MO2-ocrl Fig. 4 with image from Luo et al., 2013
melanosome localization disrupted, abnormal WT + MO2-ocrl Fig. 4 with image from Luo et al., 2013
pericardium edematous, abnormal WT + MO2-ocrl Fig. 2 from Rbaibi et al., 2012
post-vent region kinked, abnormal AB/TU + MO2-ocrl Fig. 5 from Luo et al., 2012
pronephric proximal convoluted tubule decreased length, abnormal AB + MO2-ocrl Fig. S5 from Gliozzi et al., 2019
pronephric tubule increased width, abnormal WT + MO2-ocrl Fig. 4 from Rbaibi et al., 2012
pronephric tubule cilium disorganized, abnormal WT + MO2-ocrl Fig. 4 from Rbaibi et al., 2012
pronephric tubule cilium increased length, abnormal WT + MO2-ocrl Fig. 4 from Rbaibi et al., 2012
proximal straight tubule decreased length, abnormal AB + MO2-ocrl Fig. S5 from Gliozzi et al., 2019
renal filtration disrupted, abnormal WT + MO2-ocrl Fig. 3 from Rbaibi et al., 2012
retina deformed, abnormal AB/TU + MO2-ocrl Fig. 5,  Fig. S5 from Luo et al., 2012
retina layer formation process quality, abnormal AB/TU + MO2-ocrl Fig. 5 from Luo et al., 2012
ventricular system distended, abnormal AB/TU + MO2-ocrl Fig. 5 from Luo et al., 2012
whole organism curled, abnormal AB/TL + MO2-ocrl Fig. S1 from Coon et al., 2012
whole organism decreased pigmentation, abnormal AB/TU + MO2-ocrl Fig. 5,  Fig. S5 from Luo et al., 2012
whole organism edematous, abnormal AB/TU + MO2-ocrl Fig. 5 from Luo et al., 2012
whole organism increased curvature, abnormal WT + MO2-ocrl Fig. 2 from Rbaibi et al., 2012
whole organism anterior-posterior axis asymmetrical, abnormal AB/TU + MO2-ocrl Fig. 5 from Luo et al., 2012
whole organism anterior-posterior axis decreased length, abnormal AB/TL + MO2-ocrl Fig. S1 from Coon et al., 2012
Phenotype of all Fish created by or utilizing MO2-ocrl
Phenotype Fish Conditions Figures
pronephric proximal convoluted tubule decreased length, abnormal AB + MO2-ocrl standard conditions Fig. S5 from Gliozzi et al., 2019
proximal straight tubule decreased length, abnormal AB + MO2-ocrl standard conditions Fig. S5 from Gliozzi et al., 2019
melanocyte decreased amount, abnormal AB/TL + MO2-ocrl standard conditions Fig. S1 from Coon et al., 2012
eye decreased size, abnormal AB/TL + MO2-ocrl standard conditions Fig. S1 from Coon et al., 2012
whole organism curled, abnormal AB/TL + MO2-ocrl standard conditions Fig. S1 from Coon et al., 2012
melanocyte mislocalised, abnormal AB/TL + MO2-ocrl standard conditions Fig. S1 from Coon et al., 2012
head decreased size, abnormal AB/TL + MO2-ocrl standard conditions Fig. S1 from Coon et al., 2012
whole organism anterior-posterior axis decreased length, abnormal AB/TL + MO2-ocrl standard conditions Fig. S1 from Coon et al., 2012
post-vent region kinked, abnormal AB/TU + MO2-ocrl standard conditions Fig. 5 from Luo et al., 2012
whole organism edematous, abnormal AB/TU + MO2-ocrl standard conditions Fig. 5 from Luo et al., 2012
whole organism anterior-posterior axis asymmetrical, abnormal AB/TU + MO2-ocrl standard conditions Fig. 5 from Luo et al., 2012
whole organism decreased pigmentation, abnormal AB/TU + MO2-ocrl standard conditions Fig. 5,  Fig. S5 from Luo et al., 2012
eye decreased size, abnormal AB/TU + MO2-ocrl standard conditions Fig. 5,  Fig. S5 from Luo et al., 2012
Kupffer's vesicle cilium decreased length, abnormal AB/TU + MO2-ocrl standard conditions Fig. S5 from Luo et al., 2012
retina layer formation process quality, abnormal AB/TU + MO2-ocrl standard conditions Fig. 5 from Luo et al., 2012
ventricular system distended, abnormal AB/TU + MO2-ocrl standard conditions Fig. 5 from Luo et al., 2012
lens decreased size, abnormal AB/TU + MO2-ocrl standard conditions Fig. 5,  Fig. S5 from Luo et al., 2012
Kupffer's vesicle has fewer parts of type ciliated epithelial cell cilium, abnormal AB/TU + MO2-ocrl standard conditions Fig. 5 from Luo et al., 2012
retina deformed, abnormal AB/TU + MO2-ocrl standard conditions Fig. 5,  Fig. S5 from Luo et al., 2012
renal filtration disrupted, abnormal WT + MO2-ocrl standard conditions Fig. 3 from Rbaibi et al., 2012
brain hydrocephalic, abnormal WT + MO2-ocrl standard conditions Fig. 2 from Rbaibi et al., 2012
embryo development disrupted, abnormal WT + MO2-ocrl standard conditions Fig. 2 from Rbaibi et al., 2012
cellular response to epinephrine stimulus delayed, abnormal WT + MO2-ocrl standard conditions Fig. 4 with image from Luo et al., 2013
pronephric tubule increased width, abnormal WT + MO2-ocrl standard conditions Fig. 4 from Rbaibi et al., 2012
pronephric tubule cilium disorganized, abnormal WT + MO2-ocrl standard conditions Fig. 4 from Rbaibi et al., 2012
whole organism increased curvature, abnormal WT + MO2-ocrl standard conditions Fig. 2 from Rbaibi et al., 2012
pronephric tubule cilium increased length, abnormal WT + MO2-ocrl standard conditions Fig. 4 from Rbaibi et al., 2012
melanocyte melanosome spatial pattern, abnormal WT + MO2-ocrl standard conditions Fig. 4 with image from Luo et al., 2013
pericardium edematous, abnormal WT + MO2-ocrl standard conditions Fig. 2 from Rbaibi et al., 2012
Kupffer's vesicle cilium decreased length, abnormal WT + MO2-ocrl standard conditions Fig. 7 with image from Luo et al., 2013
melanosome localization disrupted, abnormal WT + MO2-ocrl standard conditions Fig. 4 with image from Luo et al., 2013
eye decreased size, abnormal WT + MO2-inpp5b + MO2-ocrl standard conditions Fig. 6 with image from Luo et al., 2013
whole organism anterior-posterior axis asymmetrical, abnormal WT + MO2-inpp5b + MO2-ocrl standard conditions Fig. 6 with image from Luo et al., 2013
whole organism dead, abnormal WT + MO2-inpp5b + MO2-ocrl standard conditions Fig. 6 with image from Luo et al., 2013
pericardium edematous, abnormal WT + MO2-inpp5b + MO2-ocrl standard conditions Fig. 6 with image from Luo et al., 2013
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.