Morpholino
MO1-ocrl
- ID
- ZDB-MRPHLNO-120405-1
- Name
- MO1-ocrl
- Previous Names
-
- ATGMO (1)
- Target
- Sequence
-
5' - AATCCCAAATGAAGGTTCCATCATG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ocrl
Expressed Gene | Anatomy | Figures |
---|---|---|
egr2b |
Fig. S7
from Ramirez et al., 2012 |
|
hoxb1a |
Fig. S7
from Ramirez et al., 2012 |
|
ocrl |
Fig. 3
from Ramirez et al., 2012 |
|
pax2a |
Fig. S7
from Ramirez et al., 2012 |
1 - 4 of 4
Phenotype
Phenotype resulting from MO1-ocrl
1 - 5 of 10 Show all
Phenotype of all Fish created by or utilizing MO1-ocrl
1 - 5 of 14 Show all
Citations
- Naylor, R.W., Lemarie, E., Jackson-Crawford, A., Davenport, J.B., Mironov, A., Lowe, M., Lennon, R. (2022) A novel nanoluciferase transgenic reporter measures proteinuria in zebrafish. Kidney International. 102(4):815-827
- Oltrabella, F., Jackson-Crawford, A., Yan, G., Rixham, S., Starborg, T., Lowe, M. (2021) IPIP27A cooperates with OCRL to support endocytic traffic in the zebrafish pronephric tubule. Human molecular genetics. 31(8):1183-1196
- Ates, K.M., Wang, T., Moreland, T., Veeranan-Karmegam, R., Ma, M., Jeter, C., Anand, P., Wenzel, W., Kim, H.G., Wolfe, L.A., Stephen, J.A., Adams, D.R., Markello, T., Tifft, C.J., Settlage, R., Gahl, W.A., Gonsalvez, G.B., Malicdan, M.C., Flanagan-Steet, H., Pan, Y.A. (2020) Deficiency in the endocytic adaptor proteins PHETA1/2 impair renal and craniofacial development. Disease models & mechanisms. 13(5):
- Oltrabella, F., Pietka, G., Ramirez, I.B., Mironov, A., Starborg, T., Drummond, I.A., Hinchliffe, K.A., Lowe, M. (2015) The Lowe Syndrome Protein OCRL1 Is Required for Endocytosis in the Zebrafish Pronephric Tubule. PLoS Genetics. 11:e1005058
- Ramirez, I.B., Pietka, G., Jones, D.R., Divecha, N., Aliam, A., Baraban, S.C., Hurlstone, A.F., and Lowe, M. (2012) Impaired Neural Development in a Zebrafish Model for Lowe Syndrome. Human molecular genetics. 21(8):1744-1759
1 - 5 of 5
Show