Morpholino
MO1-nfe2l2b
- ID
- ZDB-MRPHLNO-120320-13
- Name
- MO1-nfe2l2b
- Previous Names
- None
- Target
- Sequence
-
5' - AGCTGAAAGGTCGTCCATGTCTTCC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-nfe2l2b
No data available
Phenotype
Phenotype resulting from MO1-nfe2l2b
1 - 5 of 5
Phenotype of all Fish created by or utilizing MO1-nfe2l2b
1 - 5 of 7 Show all
Citations
- Abate, G., Pezzotta, A., Pucci, M., Bortolotto, V., Ribaudo, G., Bonini, S.A., Mastinu, A., Maccarinelli, G., Ongaro, A., Tirelli, E., Zizioli, D., Gianoncelli, A., Memo, M., Grilli, M., Uberti, D. (2024) The Bioactive Gamma-Oryzanol from Oryza sativa L. Promotes Neuronal Differentiation in Different In Vitro and In Vivo Models. Antioxidants (Basel, Switzerland). 13(8):
- Jin, B., Xie, L., Zhan, D., Zhou, L., Feng, Z., He, J., Qin, J., Zhao, C., Luo, L., Li, L. (2022) Nrf2 dictates the neuronal survival and differentiation of embryonic zebrafish harboring compromised alanyl-tRNA synthetase. Development (Cambridge, England). 149(17)
- Van Hall-Beauvais, A., Poganik, J.R., Huang, K.T., Parvez, S., Zhao, Y., Lin, H.Y., Liu, X., Long, M.J.C., Aye, Y. (2022) Z-REX uncovers a bifurcation in function of Keap1 paralogs. eLIFE. 11:
- Guan, R., Wen, X.Y., Leung, C.H., Ciano-Oliveira, C.D., Lam, S., Dai, S.Y., Karbassi, F., Mauro, A., Wang, Y., Rotstein, O. (2021) Plasma obtained following murine hindlimb ischemic conditioning protects against oxidative stress in zebrafish models through activation of nrf2a and downregulation of duox. PLoS One. 16:e0260442
- Sant, K.E., Moreau, H.M., Williams, L.M., Jacobs, H.M., Bowsher, A.M., Boisvert, J.D., Smolowitz, R.M., Pantazis, J., Annunziato, K., Nguyen, M., Timme-Laragy, A. (2020) Embryonic exposures to mono-2-ethylhexyl phthalate induce larval steatosis in zebrafish independent of Nrf2a signaling. Journal of developmental origins of health and disease. 12(1):132-140
- Sant, K.E., Hansen, J.M., Williams, L.M., Tran, N.L., Goldstone, J.V., Stegeman, J.J., Hahn, M.E., Timme-Laragy, A. (2017) The role of Nrf1 and Nrf2 in the regulation of glutathione and redox dynamics in the developing zebrafish embryo. Redox Biology. 13:207-218
- Williams, L.M., Timme-Laragy, A.R., Goldstone, J.V., McArthur, A.G., Stegeman, J.J., Smolowitz, R.M., and Hahn, M.E. (2013) Developmental expression of the Nfe2-related factor (Nrf) transcription factor family in the zebrafish, Danio rerio. PLoS One. 8(10):e79574
- Timme-Laragy, A.R., Karchner, S.I., Franks, D.G., Jenny, M.J., Harbeitner, R.C., Goldstone, J.V., McArthur, A.G., and Hahn, M.E. (2012) Nrf2b: novel zebrafish paralog of the oxidant-responsive transcription factor NF-E2-related factor 2 (NRF2). The Journal of biological chemistry. 287(7):4609-4627
1 - 8 of 8
Show