Morpholino
MO1-ahi1
- ID
- ZDB-MRPHLNO-120314-2
- Name
- MO1-ahi1
- Previous Names
-
- SPL8MO (1)
- Target
- Sequence
-
5' - CCACACTCTGAAAGGGAAAAACATT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ahi1
No data available
Phenotype
Phenotype resulting from MO1-ahi1
1 - 5 of 20 Show all
Phenotype of all Fish created by or utilizing MO1-ahi1
1 - 5 of 23 Show all
Citations
- Zhu, L., Chen, L., Yan, L., Perkins, B.D., Li, S., Li, B., Xu, H.A., Li, X.J. (2019) Mutant Ahi1 Affects Retinal Axon Projection in Zebrafish via Toxic Gain of Function. Frontiers in Cellular Neuroscience. 13:81
- Elsayed, S.M., Phillips, J.B., Heller, R., Thoenes, M., Elsobky, E., Nürnberg, G., Nürnberg, P., Seland, S., Ebermann, I., Altmüller, J., Thiele, H., Toliat, M., Körber, F., Hu, X., Wu, Y.D., Zaki, M.S., Abdel-Salam, G., Gleeson, J., Boltshauser, E., Westerfield, M., Bolz, H.J. (2015) Non-manifesting AHI1 truncations indicate localized loss-of-function tolerance in a severe Mendelian disease gene. Human molecular genetics. 24(9):2594-603
- Simms, R.J., Hynes, A.M., Eley, L., Inglis, D., Chaudhry, B., Dawe, H.R., and Sayer, J.A. (2012) Modelling a ciliopathy: Ahi1 knockdown in model systems reveals an essential role in brain, retinal, and renal development. Cellular and molecular life sciences : CMLS. 69(6):993-1009
1 - 3 of 3
Show