Morpholino

MO2-tnfrsf19

ID

ZDB-MRPHLNO-120302-5

Name

MO2-tnfrsf19

Previous Names

Target

Sequence

5' - GCTCTGATGTTTGCTGACCTTCAGT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-tnfrsf19

Expressed Gene	Anatomy	Figures
tnfrsf19	whole organism	Fig. S5 from Tam et al., 2012

Phenotype

Phenotype resulting from MO2-tnfrsf19

Phenotype	Fish	Figures
angiogenesis decreased process quality, abnormal	s843Tg + MO2-tnfrsf19	Fig. 2 from Tam et al., 2012
brain vasculature has fewer parts of type central artery, abnormal	s843Tg + MO2-tnfrsf19	Fig. 5 from Tam et al., 2012
brain vasculature increased permeability, abnormal	s843Tg + MO2-tnfrsf19	Fig. 2 from Tam et al., 2012
central artery decreased branchiness, abnormal	s843Tg + MO2-tnfrsf19	Fig. 2 from Tam et al., 2012
establishment of blood-brain barrier decreased process quality, abnormal	s843Tg + MO2-tnfrsf19	Fig. 2 from Tam et al., 2012
sprouting angiogenesis decreased process quality, abnormal	s843Tg + MO2-tnfrsf19	Fig. 5 from Tam et al., 2012

Phenotype of all Fish created by or utilizing MO2-tnfrsf19

Phenotype	Fish	Conditions	Figures
brain vasculature has fewer parts of type central artery, abnormal	s843Tg + MO2-tnfrsf19	standard conditions	Fig. 5 from Tam et al., 2012
angiogenesis decreased process quality, abnormal	s843Tg + MO2-tnfrsf19	standard conditions	Fig. 2 from Tam et al., 2012
sprouting angiogenesis decreased process quality, abnormal	s843Tg + MO2-tnfrsf19	standard conditions	Fig. 5 from Tam et al., 2012
central artery decreased branchiness, abnormal	s843Tg + MO2-tnfrsf19	standard conditions	Fig. 2 from Tam et al., 2012
establishment of blood-brain barrier decreased process quality, abnormal	s843Tg + MO2-tnfrsf19	standard conditions	Fig. 2 from Tam et al., 2012
brain vasculature increased permeability, abnormal	s843Tg + MO2-tnfrsf19	standard conditions	Fig. 2 from Tam et al., 2012
brain vasculature increased permeability, abnormal	s843Tg + MO1-tnfrsf21 + MO2-tnfrsf19	standard conditions	Fig. 6 from Tam et al., 2012
establishment of blood-brain barrier decreased process quality, abnormal	s843Tg + MO1-tnfrsf21 + MO2-tnfrsf19	standard conditions	Fig. 6 from Tam et al., 2012
sprouting angiogenesis decreased process quality, abnormal	s843Tg + MO1-tnfrsf21 + MO2-tnfrsf19	standard conditions	Fig. 6 from Tam et al., 2012
brain vasculature has fewer parts of type central artery, abnormal	s843Tg + MO1-tnfrsf21 + MO2-tnfrsf19	standard conditions	Fig. 6 from Tam et al., 2012

Citations