Morpholino

MO4-dsc2l

ID
ZDB-MRPHLNO-120227-3
Name
MO4-dsc2l
Previous Names
  • Dsc 1 ATG block (1)
Target
Sequence
5' - GCGTTCATACATCCTGAAGCGAGAG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-dsc2l
No data available
Phenotype
Phenotype resulting from MO4-dsc2l
Phenotype Fish Figures
convergent extension involved in gastrulation disrupted, abnormal TL + MO4-dsc2l Fig. 6 with image from Goonesinghe et al., 2012
desmosome assembly disrupted, abnormal TL + MO4-dsc2l Fig. 8 with image from Goonesinghe et al., 2012
epiboly involved in gastrulation with mouth forming second arrested, abnormal TL + MO4-dsc2l Fig. 5 with image from Goonesinghe et al., 2012
epiboly involved in gastrulation with mouth forming second delayed, abnormal TL + MO4-dsc2l Fig. 5 with image from Goonesinghe et al., 2012
epidermal cell desmosome decreased amount, abnormal TL + MO4-dsc2l Fig. 8 with image from Goonesinghe et al., 2012
epidermal cell desmosome malformed, abnormal TL + MO4-dsc2l Fig. 8 with image from Goonesinghe et al., 2012
EVL detached from external yolk syncytial layer, abnormal TL + MO4-dsc2l Fig. 5 with image from Goonesinghe et al., 2012
head development disrupted, abnormal TL + MO4-dsc2l Fig. 4 with image from Goonesinghe et al., 2012
notochord kinked, abnormal TL + MO4-dsc2l Fig. 4 with image from Goonesinghe et al., 2012
notochord undulate, abnormal TL + MO4-dsc2l Fig. 6 with image from Goonesinghe et al., 2012
post-vent region curved, abnormal TL + MO4-dsc2l Fig. 4 with image from Goonesinghe et al., 2012
somite absent, abnormal TL + MO4-dsc2l Fig. 4 with image from Goonesinghe et al., 2012
somite morphology, abnormal TL + MO4-dsc2l Fig. 6 with image from Goonesinghe et al., 2012
somitogenesis disrupted, abnormal TL + MO4-dsc2l Fig. 4 with image from Goonesinghe et al., 2012
whole organism dead, abnormal TL + MO4-dsc2l Fig. 4 with image from Goonesinghe et al., 2012
whole organism anterior-posterior axis decreased length, abnormal TL + MO4-dsc2l Fig. 4 with imageFig. 6 with image from Goonesinghe et al., 2012
Phenotype of all Fish created by or utilizing MO4-dsc2l
Phenotype Fish Conditions Figures
convergent extension involved in gastrulation disrupted, abnormal TL + MO4-dsc2l standard conditions Fig. 6 with image from Goonesinghe et al., 2012
epiboly involved in gastrulation with mouth forming second arrested, abnormal TL + MO4-dsc2l standard conditions Fig. 5 with image from Goonesinghe et al., 2012
post-vent region curved, abnormal TL + MO4-dsc2l standard conditions Fig. 4 with image from Goonesinghe et al., 2012
EVL detached from external yolk syncytial layer, abnormal TL + MO4-dsc2l standard conditions Fig. 5 with image from Goonesinghe et al., 2012
notochord kinked, abnormal TL + MO4-dsc2l standard conditions Fig. 4 with image from Goonesinghe et al., 2012
notochord undulate, abnormal TL + MO4-dsc2l standard conditions Fig. 6 with image from Goonesinghe et al., 2012
somite morphology, abnormal TL + MO4-dsc2l standard conditions Fig. 6 with image from Goonesinghe et al., 2012
epidermal cell desmosome malformed, abnormal TL + MO4-dsc2l standard conditions Fig. 8 with image from Goonesinghe et al., 2012
epidermal cell desmosome decreased amount, abnormal TL + MO4-dsc2l standard conditions Fig. 8 with image from Goonesinghe et al., 2012
somite absent, abnormal TL + MO4-dsc2l standard conditions Fig. 4 with image from Goonesinghe et al., 2012
whole organism dead, abnormal TL + MO4-dsc2l standard conditions Fig. 4 with image from Goonesinghe et al., 2012
whole organism anterior-posterior axis decreased length, abnormal TL + MO4-dsc2l standard conditions Fig. 4 with imageFig. 6 with image from Goonesinghe et al., 2012
desmosome assembly disrupted, abnormal TL + MO4-dsc2l standard conditions Fig. 8 with image from Goonesinghe et al., 2012
epiboly involved in gastrulation with mouth forming second delayed, abnormal TL + MO4-dsc2l standard conditions Fig. 5 with image from Goonesinghe et al., 2012
head development disrupted, abnormal TL + MO4-dsc2l standard conditions Fig. 4 with image from Goonesinghe et al., 2012
somitogenesis disrupted, abnormal TL + MO4-dsc2l standard conditions Fig. 4 with image from Goonesinghe et al., 2012
Citations