Morpholino
MO1-cxcl8a
- ID
- ZDB-MRPHLNO-120222-5
- Name
- MO1-cxcl8a
- Previous Names
-
- IL-8-SB1-Mo, targeting exon2-intron2 junction) (1)
- Target
- Sequence
-
5' - CGTATTAGTTTGAAAACTCACATGA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-cxcl8a
No data available
Phenotype
Phenotype resulting from MO1-cxcl8a
1 - 3 of 3
Phenotype of all Fish created by or utilizing MO1-cxcl8a
1 - 5 of 5
Citations
- Wang, Z., Lin, L., Chen, W., Zheng, X., Zhang, Y., Liu, Q., Yang, D. (2019) Neutrophil plays critical role during Edwardsiella piscicida immersion infection in zebrafish larvae. Fish & shellfish immunology. 87:565-572
- Cortes, M., Chen, M.J., Stachura, D.L., Liu, S.Y., Kwan, W., Wright, F., Vo, L.T., Theodore, L.N., Esain, V., Frost, I.M., Schlaeger, T.M., Goessling, W., Daley, G.Q., North, T.E. (2016) Developmental Vitamin D Availability Impacts Hematopoietic Stem Cell Production. Cell Reports. 17:458-468
- Jing, L., Tamplin, O.J., Chen, M.J., Deng, Q., Patterson, S., Kim, P.G., Durand, E.M., McNeil, A., Green, J.M., Matsuura, S., Ablain, J., Brandt, M.K., Schlaeger, T.M., Huttenlocher, A., Daley, G.Q., Ravid, K., Zon, L.I. (2015) Adenosine signaling promotes hematopoietic stem and progenitor cell emergence. The Journal of experimental medicine. 212(5):649-63
- Stoll, S.J., Bartsch, S., Augustin, H.G., and Kroll, J. (2011) The Transcription Factor HOXC9 Regulates Endothelial Cell Quiescence and Vascular Morphogenesis in Zebrafish via Inhibition of Interleukin 8. Circulation research. 108:1367-1377
1 - 4 of 4
Show