Morpholino

MO2-nolc1

ID
ZDB-MRPHLNO-120203-3
Name
MO2-nolc1
Previous Names
  • ex7:in7-MO (1)
Target
Sequence
5' - ATGAGAAAGTTAGGCAATACCAGTC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-nolc1
No data available
Phenotype
Phenotype resulting from MO2-nolc1
No data available
Phenotype of all Fish created by or utilizing MO2-nolc1
Phenotype Fish Conditions Figures
brain hypoplastic, abnormal WT + MO1-nolc1 + MO2-nolc1 standard conditions Fig. 5 with image from Weiner et al., 2012
embryonic cranial skeleton morphogenesis disrupted, abnormal WT + MO1-nolc1 + MO2-nolc1 standard conditions Fig. 7 with image from Weiner et al., 2012
Meckel's cartilage shape, abnormal WT + MO1-nolc1 + MO2-nolc1 standard conditions Fig. 7 with image from Weiner et al., 2012
swim bladder inflation disrupted, abnormal WT + MO1-nolc1 + MO2-nolc1 standard conditions Fig. 5 with image from Weiner et al., 2012
retina apoptotic, abnormal WT + MO1-nolc1 + MO2-nolc1 standard conditions Fig. 5 with image from Weiner et al., 2012
brain apoptotic, abnormal WT + MO1-nolc1 + MO2-nolc1 standard conditions Fig. 5 with image from Weiner et al., 2012
midbrain hindbrain boundary apoptotic, abnormal WT + MO1-nolc1 + MO2-nolc1 standard conditions Fig. 5 with image from Weiner et al., 2012
olfactory region hypoplastic, abnormal WT + MO1-nolc1 + MO2-nolc1 standard conditions Fig. 5 with image from Weiner et al., 2012
gut malformed, abnormal WT + MO1-nolc1 + MO2-nolc1 standard conditions Fig. 5 with image from Weiner et al., 2012
optic primordium malformed, abnormal WT + MO1-nolc1 + MO2-nolc1 standard conditions Fig. 5 with image from Weiner et al., 2012
ceratohyal cartilage malformed, abnormal WT + MO1-nolc1 + MO2-nolc1 standard conditions Fig. 7 with image from Weiner et al., 2012
cranial cartilage chondrocyte disorganized, abnormal WT + MO1-nolc1 + MO2-nolc1 standard conditions Fig. 7 with image from Weiner et al., 2012
eye decreased size, abnormal WT + MO1-nolc1 + MO2-nolc1 standard conditions Fig. 5 with image from Weiner et al., 2012
pharyngeal arch decreased size, abnormal WT + MO1-nolc1 + MO2-nolc1 standard conditions Fig. 7 with image from Weiner et al., 2012
cranial cartilage chondrocyte increased size, abnormal WT + MO1-nolc1 + MO2-nolc1 standard conditions Fig. 7 with image from Weiner et al., 2012
palatoquadrate cartilage decreased size, abnormal WT + MO1-nolc1 + MO2-nolc1 standard conditions Fig. 7 with image from Weiner et al., 2012
ethmoid cartilage decreased size, abnormal WT + MO1-nolc1 + MO2-nolc1 standard conditions Fig. 7 with image from Weiner et al., 2012
otic vesicle hypoplastic, abnormal WT + MO1-nolc1 + MO2-nolc1 standard conditions Fig. 5 with image from Weiner et al., 2012
ceratohyal cartilage obtuse angle to ceratohyal cartilage, abnormal WT + MO1-nolc1 + MO2-nolc1 standard conditions Fig. 7 with image from Weiner et al., 2012
head circular, abnormal WT + MO1-nolc1 + MO2-nolc1 standard conditions Fig. 5 with image from Weiner et al., 2012
head truncated, abnormal WT + MO1-nolc1 + MO2-nolc1 standard conditions Fig. 5 with image from Weiner et al., 2012
cranial cartilage chondrocyte circular, abnormal WT + MO1-nolc1 + MO2-nolc1 standard conditions Fig. 7 with image from Weiner et al., 2012
Meckel's cartilage decreased length, abnormal WT + MO1-nolc1 + MO2-nolc1 standard conditions Fig. 7 with image from Weiner et al., 2012
cranial cartilage hypoplastic, abnormal WT + MO1-nolc1 + MO2-nolc1 standard conditions Fig. 7 with image from Weiner et al., 2012
pericardium edematous, abnormal WT + MO1-nolc1 + MO2-nolc1 standard conditions Fig. 5 with image from Weiner et al., 2012
ethmoid cartilage malformed, abnormal WT + MO1-nolc1 + MO2-nolc1 standard conditions Fig. 7 with image from Weiner et al., 2012
ceratobranchial cartilage malformed, abnormal WT + MO1-nolc1 + MO2-nolc1 standard conditions Fig. 7 with image from Weiner et al., 2012
hyosymplectic cartilage decreased size, abnormal WT + MO1-nolc1 + MO2-nolc1 standard conditions Fig. 7 with image from Weiner et al., 2012
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.