Morpholino

MO1-enpp2

ID
ZDB-MRPHLNO-120123-5
Name
MO1-enpp2
Previous Names
  • ATX MO1 (1)
Target
Sequence
5' - GGAGAATACCTGGGTCGAGACACCG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genome Build: GRCz11Chromosome: 16
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-enpp2
Expressed Gene Anatomy Figures
enpp2 Fig. 5 from Yukiura et al., 2011
Phenotype
Phenotype resulting from MO1-enpp2
Phenotype Fish Figures
angiogenesis disrupted, abnormal y1Tg + MO1-enpp2 (AB) Fig. 5 from Yukiura et al., 2011
cartilage development process quality, abnormal AB + MO1-enpp2 Fig. 1 with image from Nishioka et al., 2016
ceratohyal cartilage deformed, abnormal AB + MO1-enpp2 Fig. 1 with image from Nishioka et al., 2016
ceratohyal cartilage chondrocyte disorganized, abnormal zf678Tg + MO1-enpp2 Fig. 1 with image from Nishioka et al., 2016
ceratohyal cartilage chondrocyte increased variability of size, abnormal zf678Tg + MO1-enpp2 Fig. 1 with image from Nishioka et al., 2016
cranium malformed, abnormal zf678Tg + MO1-enpp2 Fig. 1 with image,  Fig. S1 with image from Nishioka et al., 2016
dorsal longitudinal anastomotic vessel aplastic, abnormal y1Tg + MO1-enpp2 (AB) Fig. 5 from Yukiura et al., 2011
head circular, abnormal AB + MO1-enpp2 Fig. 1 with image from Nishioka et al., 2016
head edematous, abnormal AB + MO1-enpp2 Fig. 5 from Yukiura et al., 2011
intersegmental artery attached to intersegmental vessel, abnormal y1Tg + MO1-enpp2 (AB) Fig. 5 from Yukiura et al., 2011
intersegmental artery attached to intersegmental artery, abnormal y1Tg + MO1-enpp2 (AB) Fig. 5 from Yukiura et al., 2011
intersegmental artery decreased length, abnormal y1Tg + MO1-enpp2 (AB) Fig. 5 from Yukiura et al., 2011
Meckel's cartilage deformed, abnormal AB + MO1-enpp2 Fig. 1 with image from Nishioka et al., 2016
Meckel's cartilage chondrocyte disorganized, abnormal zf678Tg + MO1-enpp2 Fig. 1 with image from Nishioka et al., 2016
Meckel's cartilage chondrocyte increased variability of size, abnormal zf678Tg + MO1-enpp2 Fig. 1 with image from Nishioka et al., 2016
pericardium edematous, abnormal AB + MO1-enpp2 Fig. 5 from Yukiura et al., 2011
Phenotype of all Fish created by or utilizing MO1-enpp2
Phenotype Fish Conditions Figures
head edematous, abnormal AB + MO1-enpp2 standard conditions Fig. 5 from Yukiura et al., 2011
cranium malformed, abnormal AB + MO1-enpp2 standard conditions Fig. 1 with image from Nishioka et al., 2016
pericardium edematous, abnormal AB + MO1-enpp2 standard conditions Fig. 5 from Yukiura et al., 2011
cartilage development process quality, abnormal AB + MO1-enpp2 standard conditions Fig. 1 with image from Nishioka et al., 2016
Meckel's cartilage deformed, abnormal AB + MO1-enpp2 standard conditions Fig. 1 with image from Nishioka et al., 2016
head circular, abnormal AB + MO1-enpp2 standard conditions Fig. 1 with image from Nishioka et al., 2016
ceratohyal cartilage deformed, abnormal AB + MO1-enpp2 standard conditions Fig. 1 with image from Nishioka et al., 2016
intersegmental artery decreased length, abnormal y1Tg + MO1-enpp2 (AB) standard conditions Fig. 5 from Yukiura et al., 2011
angiogenesis disrupted, abnormal y1Tg + MO1-enpp2 (AB) standard conditions Fig. 5 from Yukiura et al., 2011
dorsal longitudinal anastomotic vessel aplastic, abnormal y1Tg + MO1-enpp2 (AB) standard conditions Fig. 5 from Yukiura et al., 2011
intersegmental artery attached to intersegmental artery, abnormal y1Tg + MO1-enpp2 (AB) standard conditions Fig. 5 from Yukiura et al., 2011
intersegmental artery attached to intersegmental vessel, abnormal y1Tg + MO1-enpp2 (AB) standard conditions Fig. 5 from Yukiura et al., 2011
Meckel's cartilage chondrocyte disorganized, abnormal zf678Tg + MO1-enpp2 standard conditions Fig. 1 with image from Nishioka et al., 2016
ceratohyal cartilage chondrocyte increased variability of size, abnormal zf678Tg + MO1-enpp2 standard conditions Fig. 1 with image from Nishioka et al., 2016
cranium malformed, abnormal zf678Tg + MO1-enpp2 standard conditions Fig. S1 with image from Nishioka et al., 2016
ceratohyal cartilage chondrocyte disorganized, abnormal zf678Tg + MO1-enpp2 standard conditions Fig. 1 with image from Nishioka et al., 2016
Meckel's cartilage chondrocyte increased variability of size, abnormal zf678Tg + MO1-enpp2 standard conditions Fig. 1 with image from Nishioka et al., 2016
Citations
TSV
1 - 3 of 3
Show
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.