Morpholino

MO1-lyn

ID
ZDB-MRPHLNO-120118-1
Name
MO1-lyn
Previous Names
  • lyn MO1 (1)
Target
Sequence
5' - TCAGACAGCAAATAGTAATCACCTT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-lyn
No data available
Phenotype
Phenotype resulting from MO1-lyn
Phenotype of all Fish created by or utilizing MO1-lyn
Phenotype Fish Conditions Figures
blood island neutrophil increased amount, abnormal AB + MO1-lyn standard conditions Fig. S5 from Yoo et al., 2011
neutrophil chemotaxis disrupted, abnormal AB + MO1-lyn physical alteration: anatomical structure Fig. 2 from Yoo et al., 2011
response to wounding disrupted, abnormal AB + MO1-lyn physical alteration: anatomical structure Fig. 2 from Yoo et al., 2011
neutrophil chemotaxis disrupted, abnormal WT + MO1-lyn physical alteration: anatomical structure Fig. 4 from Yoo et al., 2011
whole organism cxcl8b.1 expression amount, ameliorated WT + MO1-lyn amputation: caudal fin Fig. 3 from de Oliveira et al., 2015
response to wounding disrupted, abnormal WT + MO1-lyn physical alteration: anatomical structure Fig. 4 from Yoo et al., 2011
neutrophil chemotaxis decreased occurrence, abnormal i114Tg + MO1-lyn amputation: caudal fin Fig. 3 from de Oliveira et al., 2015
response to wounding disrupted, abnormal uwm4Tg + MO1-lyn physical alteration: anatomical structure Fig. 2 from Yoo et al., 2011
neutrophil chemotaxis disrupted, abnormal uwm4Tg + MO1-lyn physical alteration: anatomical structure Fig. 2 from Yoo et al., 2011
peptidyl-tyrosine autophosphorylation decreased occurrence, abnormal uwm5Tg + MO1-lyn physical alteration: anatomical structure Fig. 2 from Yoo et al., 2011
neutrophil chemotaxis disrupted, abnormal zf309Tg + MO1-lyn physical alteration: anatomical structure Fig. 4 from Yoo et al., 2011
response to wounding disrupted, abnormal zf309Tg + MO1-lyn physical alteration: anatomical structure Fig. 4 from Yoo et al., 2011
neutrophil chemotaxis decreased occurrence, abnormal i114Tg + MO1-cxcl8b.1 + MO1-lyn amputation: caudal fin Fig. 3 from de Oliveira et al., 2015
Citations