Morpholino
MO1-lyn
- ID
- ZDB-MRPHLNO-120118-1
- Name
- MO1-lyn
- Previous Names
-
- lyn MO1 (1)
- Target
- Sequence
-
5' - TCAGACAGCAAATAGTAATCACCTT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-lyn
No data available
Phenotype
Phenotype resulting from MO1-lyn
Phenotype | Fish | Figures |
---|---|---|
blood island neutrophil increased amount, abnormal | AB + MO1-lyn |
Fig. S5
from Yoo et al., 2011 |
1 - 1 of 1
Phenotype of all Fish created by or utilizing MO1-lyn
1 - 5 of 13 Show all
Citations
- de Oliveira, S., Boudinot, P., Calado, Â., Mulero, V. (2015) Duox1-Derived H2O2 Modulates Cxcl8 Expression and Neutrophil Recruitment via JNK/c-JUN/AP-1 Signaling and Chromatin Modifications. Journal of immunology (Baltimore, Md. : 1950). 194(4):1523-33
- Candel, S., de Oliveira, S., López-Muñoz, A., García-Moreno, D., Espín-Palazón, R., Tyrkalska, S.D., Cayuela, M.L., Renshaw, S.A., Corbalán-Vélez, R., Vidal-Abarca, I., Tsai, H.J., Meseguer, J., Sepulcre, M.P., Mulero, V. (2014) Tnfa signaling through tnfr2 protects skin against oxidative stress-induced inflammation. PLoS Biology. 12:e1001855
- Tauzin, S., Starnes, T.W., Becker, F.B., Lam, P.Y., Huttenlocher, A. (2014) Redox and Src family kinase signaling control leukocyte wound attraction and neutrophil reverse migration. The Journal of cell biology. 207:589-98
- Yoo, S.K., Starnes, T.W., Deng, Q., and Huttenlocher, A. (2011) Lyn is a redox sensor that mediates leukocyte wound attraction in vivo. Nature. 480(7375):109-12
1 - 4 of 4
Show