Community Action Needed: Please respond to the NIH RFI
Morpholino

MO2-creb3l2

ID
ZDB-MRPHLNO-111215-2
Name
MO2-creb3l2
Previous Names
None
Target
Sequence
5' - CAGACCTGGACAACAGCATGACACT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
splice-blocker targeted to creb3l2 intron3-exon4 boundary
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-creb3l2
No data available
Phenotype
Phenotype resulting from MO2-creb3l2
Phenotype of all Fish created by or utilizing MO2-creb3l2
Citations