Morpholino

MO1-nipbla

ID
ZDB-MRPHLNO-111201-3
Name
MO1-nipbla
Previous Names
  • nipblb-MO1 (1)
Target
Sequence
5' - TGACGGCTGGGCACAGAAGTCTAAC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Targets the 5'UTR.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-nipbla
No data available
Phenotype
Phenotype resulting from MO1-nipbla
Phenotype of all Fish created by or utilizing MO1-nipbla
Phenotype Fish Conditions Figures
post-vent region branched, abnormal AB + MO1-nipbla standard conditions Fig. 2 with image from Muto et al., 2011
blood circulation disrupted, abnormal AB + MO1-nipbla standard conditions Fig. 2 with image from Muto et al., 2011
pericardium edematous, abnormal AB + MO1-nipbla standard conditions Fig. 2 with image from Muto et al., 2011
post-vent region decreased length, abnormal AB + MO1-nipbla standard conditions Fig. 2 with image from Muto et al., 2011
cardioblast migration disrupted, abnormal AB + MO1-nipbla + MO1-nipblb standard conditions Fig. 3 with image from Muto et al., 2011
blood circulation disrupted, abnormal AB + MO1-nipbla + MO1-nipblb standard conditions Fig. S7 with image from Muto et al., 2011
pericardium edematous, abnormal AB + MO1-nipbla + MO1-nipblb standard conditions Fig. 2 with imageFig. S7 with image from Muto et al., 2011
pectoral fin bud embryonic pectoral fin morphogenesis decreased process quality, abnormal AB + MO1-nipbla + MO1-nipblb standard conditions Fig. 4 with imageFig. 5 with image from Muto et al., 2014
apical ectodermal ridge pectoral fin bud embryonic pectoral fin morphogenesis decreased process quality, abnormal AB + MO1-nipbla + MO1-nipblb standard conditions Fig. 2 with image from Muto et al., 2014
nucleate erythrocyte increased accumulation intermediate cell mass of mesoderm, abnormal AB + MO1-nipbla + MO1-nipblb standard conditions Fig. S7 with image from Muto et al., 2011
gut absent, abnormal AB + MO1-nipbla + MO1-nipblb standard conditions Fig. 3 with image from Muto et al., 2011
nucleate erythrocyte increased accumulation yolk anatomical surface, abnormal AB + MO1-nipbla + MO1-nipblb standard conditions Fig. S7 with image from Muto et al., 2011
pectoral fin decreased length, abnormal AB + MO1-nipbla + MO1-nipblb standard conditions Fig. 1 with image from Muto et al., 2014
whole organism endodermal cell decreased amount, abnormal AB + MO1-nipbla + MO1-nipblb standard conditions Fig. 4 with image from Muto et al., 2011
cloacal chamber non-functional, abnormal AB + MO1-nipbla + MO1-nipblb standard conditions Fig. S4 with image from Muto et al., 2011
pectoral fin cartilage malformed, abnormal AB + MO1-nipbla + MO1-nipblb standard conditions Fig. 1 with image from Muto et al., 2014
gut decreased thickness, abnormal AB + MO1-nipbla + MO1-nipblb standard conditions Fig. 3 with image from Muto et al., 2011
hyosymplectic cartilage decreased amount, abnormal AB + MO1-nipbla + MO1-nipblb standard conditions Fig. S5 with image from Muto et al., 2011
left/right pattern formation disrupted, abnormal AB + MO1-nipbla + MO1-nipblb standard conditions Fig. 7 with image from Muto et al., 2011
heart looping disrupted, abnormal AB + MO1-nipbla + MO1-nipblb standard conditions Fig. 3 with image from Muto et al., 2011
heart tube aplastic, abnormal AB + MO1-nipbla + MO1-nipblb standard conditions Fig. 3 with image from Muto et al., 2011
gut malformed, abnormal AB + MO1-nipbla + MO1-nipblb standard conditions Fig. 3 with image from Muto et al., 2011
pectoral fin bud decreased size, abnormal AB + MO1-nipbla + MO1-nipblb standard conditions Fig. 1 with image from Muto et al., 2014
pectoral fin endoskeletal disc chondrocyte disorganized, abnormal AB + MO1-nipbla + MO1-nipblb standard conditions Fig. 1 with image from Muto et al., 2014
pectoral fin bud physical object quality, abnormal AB + MO1-nipbla + MO1-nipblb standard conditions Fig. 3 with image from Muto et al., 2014
fin fold pectoral fin bud embryonic pectoral fin morphogenesis decreased process quality, abnormal AB + MO1-nipbla + MO1-nipblb standard conditions Fig. 2 with image from Muto et al., 2014
pectoral fin bud regulation of smoothened signaling pathway process quality, abnormal AB + MO1-nipbla + MO1-nipblb standard conditions Fig. 3 with image from Muto et al., 2014
positive regulation of DNA-templated transcription decreased process quality, abnormal AB + MO1-nipbla + MO1-nipblb standard conditions Fig. 9 with image from Muto et al., 2014
embryonic pectoral fin morphogenesis decreased process quality, abnormal AB + MO1-nipbla + MO1-nipblb standard conditions Fig. 1 with image from Muto et al., 2014
heart jogging disrupted, abnormal AB + MO1-nipbla + MO1-nipblb standard conditions Fig. 3 with image from Muto et al., 2011
post-vent region decreased length, abnormal AB + MO1-nipbla + MO1-nipblb standard conditions Fig. 2 with image from Muto et al., 2011
heart tube bifurcated, abnormal AB + MO1-nipbla + MO1-nipblb standard conditions Fig. 3 with image from Muto et al., 2011
head decreased size, ameliorated WT + MO1-nipbla + MO1-nipblb chemical treatment: L-leucine zwitterion Fig. 2 from Xu et al., 2015
head decreased size, ameliorated WT + MO1-nipbla + MO1-nipblb standard conditions Fig. 8 from Xu et al., 2015
cell population proliferation increased occurrence, abnormal WT + MO1-nipbla + MO1-nipblb standard conditions Fig. 7 from Xu et al., 2015
heart edematous, abnormal WT + MO1-nipbla + MO1-nipblb chemical treatment: L-leucine zwitterion Fig. S7 from Xu et al., 2015
cranial cartilage cartilage development decreased process quality, ameliorated WT + MO1-nipbla + MO1-nipblb chemical treatment: L-leucine zwitterion Fig. 5 from Xu et al., 2015
whole organism lethal (sensu genetics), ameliorated WT + MO1-nipbla + MO1-nipblb chemical treatment: L-leucine zwitterion Fig. S4 from Xu et al., 2015
head decreased size, ameliorated WT + MO1-nipbla + MO1-nipblb chemical treatment: 4-methyl-2-oxopentanoic acid Fig. 8 from Xu et al., 2015
cell population proliferation increased occurrence, ameliorated WT + MO1-nipbla + MO1-nipblb chemical treatment: L-leucine zwitterion Fig. 7 from Xu et al., 2015
head apoptotic process increased occurrence, ameliorated WT + MO1-nipbla + MO1-nipblb chemical treatment: L-leucine zwitterion Fig. 6 from Xu et al., 2015
whole organism decreased length, abnormal WT + MO1-nipbla + MO1-nipblb standard conditions Fig. 1 from Xu et al., 2015
eye decreased size, ameliorated WT + MO1-nipbla + MO1-nipblb chemical treatment: L-leucine zwitterion Fig. 2 from Xu et al., 2015
translation decreased process quality, abnormal WT + MO1-nipbla + MO1-nipblb standard conditions Fig. 3Fig. 4Fig. 9 from Xu et al., 2015
whole organism lethal (sensu genetics), abnormal WT + MO1-nipbla + MO1-nipblb standard conditions Fig. 8Fig. S4 from Xu et al., 2015
trunk decreased length, ameliorated WT + MO1-nipbla + MO1-nipblb chemical treatment: L-leucine zwitterion Fig. 2 from Xu et al., 2015
head apoptotic process increased occurrence, abnormal WT + MO1-nipbla + MO1-nipblb standard conditions Fig. 6 from Xu et al., 2015
eye decreased size, abnormal WT + MO1-nipbla + MO1-nipblb chemical treatment: 4-methyl-2-oxopentanoic acid Fig. 8 from Xu et al., 2015
cranial cartilage cartilage development disrupted, abnormal WT + MO1-nipbla + MO1-nipblb standard conditions Fig. 5 from Xu et al., 2015
post-vent region apoptotic process increased occurrence, ameliorated WT + MO1-nipbla + MO1-nipblb chemical treatment: L-leucine zwitterion Fig. 6 from Xu et al., 2015
rRNA transcription decreased process quality, ameliorated WT + MO1-nipbla + MO1-nipblb chemical treatment: L-leucine zwitterion Fig. 4 from Xu et al., 2015
rRNA transcription decreased process quality, abnormal WT + MO1-nipbla + MO1-nipblb standard conditions Fig. 4Fig. 9 from Xu et al., 2015
post-vent region curved, ameliorated WT + MO1-nipbla + MO1-nipblb chemical treatment: L-leucine zwitterion Fig. 2 from Xu et al., 2015
translation decreased process quality, ameliorated WT + MO1-nipbla + MO1-nipblb chemical treatment: L-leucine zwitterion Fig. 3Fig. 4 from Xu et al., 2015
heart contraction decreased rate, abnormal WT + MO1-nipbla + MO1-nipblb chemical treatment: L-leucine zwitterion Fig. S7 from Xu et al., 2015
post-vent region curved, abnormal WT + MO1-nipbla + MO1-nipblb standard conditions Fig. 1 from Xu et al., 2015
embryo development disrupted, abnormal WT + MO1-nipbla + MO1-nipblb standard conditions Fig. 8 from Xu et al., 2015
head decreased size, abnormal WT + MO1-nipbla + MO1-nipblb standard conditions Fig. 1 from Xu et al., 2015
eye decreased size, abnormal WT + MO1-nipbla + MO1-nipblb standard conditions Fig. 1Fig. 8 from Xu et al., 2015
heart contraction decreased rate, abnormal WT + MO1-nipbla + MO1-nipblb standard conditions Fig. S7 from Xu et al., 2015
rRNA transcription decreased process quality, ameliorated WT + MO1-nipbla + MO1-nipblb chemical treatment: 4-methyl-2-oxopentanoic acid Fig. 9 from Xu et al., 2015
embryo development disrupted, ameliorated WT + MO1-nipbla + MO1-nipblb chemical treatment: 4-methyl-2-oxopentanoic acid Fig. 8 from Xu et al., 2015
heart edematous, abnormal WT + MO1-nipbla + MO1-nipblb standard conditions Fig. 1Fig. S7 from Xu et al., 2015
translation decreased process quality, ameliorated WT + MO1-nipbla + MO1-nipblb chemical treatment: 4-methyl-2-oxopentanoic acid Fig. 9 from Xu et al., 2015
whole organism lethal (sensu genetics), ameliorated WT + MO1-nipbla + MO1-nipblb chemical treatment: 4-methyl-2-oxopentanoic acid Fig. 8 from Xu et al., 2015
post-vent region apoptotic process increased occurrence, abnormal WT + MO1-nipbla + MO1-nipblb standard conditions Fig. 6 from Xu et al., 2015
embryonic pectoral fin morphogenesis decreased process quality, abnormal AB + MO1-nipbla + MO1-nipblb + MO5-med12 standard conditions Fig. 8 with image from Muto et al., 2014
pectoral fin decreased length, abnormal AB + MO1-nipbla + MO1-nipblb + MO5-med12 standard conditions Fig. 8 with image from Muto et al., 2014
pectoral fin bud embryonic pectoral fin morphogenesis decreased process quality, abnormal AB + MO1-nipbla + MO1-nipblb + MO5-med12 standard conditions Fig. 8 with image from Muto et al., 2014
Citations