Morpholino

MO1-carm1

ID
ZDB-MRPHLNO-111103-4
Name
MO1-carm1
Previous Names
None
Target
Sequence
5' - GAGAACACGGACACCGCCATCTTCG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-carm1
Expressed Gene Anatomy Figures
carm1 Fig. 2 with image from Batut et al., 2011
mef2ca Fig. 3 with image from Batut et al., 2011
myf5 Fig. 3 with image from Batut et al., 2011
myod1 Fig. 3 with image from Batut et al., 2011
myog Fig. 3 with image from Batut et al., 2011
Phenotype
Phenotype resulting from MO1-carm1
Phenotype Fish Figures
larval development process quality, abnormal WT + MO1-carm1 Fig. 4 from Selvi et al., 2015
regulation of cell cycle disrupted, abnormal WT + MO1-carm1 Fig. 6 with image from Batut et al., 2011
regulation of cell cycle increased occurrence, abnormal WT + MO1-carm1 Fig. 6 with image from Batut et al., 2011
slow muscle cell mislocalised, abnormal WT + MO1-carm1 Fig. 4 with image,  Fig. 5 with image from Batut et al., 2011
somite circular, abnormal WT + MO1-carm1 Fig. 2 with image from Batut et al., 2011
somite decreased size, abnormal WT + MO1-carm1 Fig. 2 with image from Batut et al., 2011
somite lacks parts or has fewer parts of type fast muscle cell, abnormal WT + MO1-carm1 Fig. 4 with image from Batut et al., 2011
thigmotaxis decreased process quality, abnormal WT + MO1-carm1 Fig. 5 from Selvi et al., 2015
whole organism decreased length, abnormal WT + MO1-carm1 Fig. 2 with image from Batut et al., 2011
whole organism decreased life span, abnormal WT + MO1-carm1 Fig. 4 from Selvi et al., 2015
whole organism morphology, abnormal WT + MO1-carm1 Fig. 4 from Selvi et al., 2015
Phenotype of all Fish created by or utilizing MO1-carm1
Phenotype Fish Conditions Figures
somite decreased size, abnormal WT + MO1-carm1 standard conditions Fig. 2 with image from Batut et al., 2011
whole organism morphology, abnormal WT + MO1-carm1 standard conditions Fig. 4 from Selvi et al., 2015
slow muscle cell mislocalised, abnormal WT + MO1-carm1 standard conditions Fig. 4 with image,  Fig. 5 with image from Batut et al., 2011
thigmotaxis decreased process quality, abnormal WT + MO1-carm1 standard conditions Fig. 5 from Selvi et al., 2015
regulation of cell cycle disrupted, abnormal WT + MO1-carm1 standard conditions Fig. 6 with image from Batut et al., 2011
larval development process quality, abnormal WT + MO1-carm1 standard conditions Fig. 4 from Selvi et al., 2015
somite circular, abnormal WT + MO1-carm1 standard conditions Fig. 2 with image from Batut et al., 2011
whole organism decreased life span, abnormal WT + MO1-carm1 standard conditions Fig. 4 from Selvi et al., 2015
somite lacks parts or has fewer parts of type fast muscle cell, abnormal WT + MO1-carm1 standard conditions Fig. 4 with image from Batut et al., 2011
regulation of cell cycle increased occurrence, abnormal WT + MO1-carm1 standard conditions Fig. 6 with image from Batut et al., 2011
whole organism decreased length, abnormal WT + MO1-carm1 standard conditions Fig. 2 with image from Batut et al., 2011
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.