Morpholino

MO2-klf4

ID
ZDB-MRPHLNO-111014-2
Name
MO2-klf4
Previous Names
None
Target
Sequence
5' - CAAACTCAGTCGGAGGCTGCCTCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-klf4
No data available
Phenotype
Phenotype resulting from MO2-klf4
Phenotype of all Fish created by or utilizing MO2-klf4
Phenotype Fish Conditions Figures
mid intestine goblet cell decreased amount, abnormal AB + MO1-klf4 + MO2-klf4 standard conditions Fig. 6 with image from Li et al., 2011
tectal ventricle increased size, abnormal AB + MO1-klf4 + MO2-klf4 standard conditions Fig. 2 with image from Li et al., 2011
goblet cell decreased amount, abnormal AB + MO1-klf4 + MO2-klf4 standard conditions Fig. 4 with image from Li et al., 2011
liver hypoplastic, abnormal AB + MO1-klf4 + MO2-klf4 standard conditions Fig. 2 with image from Li et al., 2011
cell population proliferation increased rate, abnormal AB + MO1-klf4 + MO2-klf4 standard conditions Fig. 7 with image from Li et al., 2011
posterior intestine goblet cell decreased amount, abnormal AB + MO1-klf4 + MO2-klf4 standard conditions Fig. 6 with image from Li et al., 2011
eye decreased size, abnormal AB + MO1-klf4 + MO2-klf4 standard conditions Fig. 2 with image from Li et al., 2011
intestine distended, abnormal AB + MO1-klf4 + MO2-klf4 standard conditions Fig. 2 with image from Li et al., 2011
swim bladder non-functional, abnormal AB + MO1-klf4 + MO2-klf4 standard conditions Fig. 2 with image from Li et al., 2011
otic vesicle decreased size, abnormal AB + MO1-klf4 + MO2-klf4 standard conditions Fig. 2 with image from Li et al., 2011
intestine hypoplastic, abnormal AB + MO1-klf4 + MO2-klf4 standard conditions Fig. 2 with image from Li et al., 2011
whole organism dorsal-ventral axis decreased length, abnormal AB + MO1-klf4 + MO2-klf4 standard conditions Fig. 2 with image from Li et al., 2011
intestinal bulb goblet cell decreased amount, abnormal AB + MO1-klf4 + MO2-klf4 standard conditions Fig. 6 with image from Li et al., 2011
goblet cell poorly differentiated, abnormal AB + MO1-klf4 + MO2-klf4 standard conditions Fig. 6 with image from Li et al., 2011
enteroendocrine cell differentiation disrupted, abnormal AB + MO1-klf4 + MO2-klf4 standard conditions Fig. 5 with image from Li et al., 2011
whole organism dorsal-ventral axis decreased length, abnormal AB + MO2-klf4 standard conditions Fig. 2 with image from Li et al., 2011
tectal ventricle increased size, abnormal AB + MO2-klf4 standard conditions Fig. 2 with image from Li et al., 2011
intestine distended, abnormal AB + MO2-klf4 standard conditions Fig. 2 with image from Li et al., 2011
swim bladder non-functional, abnormal AB + MO2-klf4 standard conditions Fig. 2 with image from Li et al., 2011
otic vesicle decreased size, abnormal AB + MO2-klf4 standard conditions Fig. 2 with image from Li et al., 2011
eye decreased size, abnormal AB + MO2-klf4 standard conditions Fig. 2 with image from Li et al., 2011
ionocyte decreased amount, abnormal WT + MO1-klf4 + MO2-klf4 standard conditions Fig 3 with imageFig. S1Fig. S4Fig. S13 from Chen et al., 2019
epidermis somatic stem cell decreased amount, abnormal WT + MO1-klf4 + MO2-klf4 standard conditions Fig. S1 from Chen et al., 2019
extension vH ionocyte decreased amount, abnormal WT + MO1-klf4 + MO2-klf4 standard conditions Fig 4 with image from Chen et al., 2019
keratinocyte decreased amount, abnormal WT + MO1-klf4 + MO2-klf4 standard conditions Fig. S1Fig. S3Fig. S4 from Chen et al., 2019
ball vH ionocyte decreased amount, abnormal WT + MO1-klf4 + MO2-klf4 standard conditions Fig. S5 from Chen et al., 2019
extension NaK ionocyte decreased amount, abnormal WT + MO1-klf4 + MO2-klf4 standard conditions Fig 4 with image from Chen et al., 2019
ball NaK ionocyte decreased amount, abnormal WT + MO1-klf4 + MO2-klf4 standard conditions Fig. S5 from Chen et al., 2019
ectoderm stem cell proliferation decreased occurrence, abnormal WT + MO1-klf4 + MO2-klf4 standard conditions Fig 5 with image from Chen et al., 2019
ionocyte decreased amount, abnormal WT + MO1-klf4 + MO2-klf4 + MO4-tp53 standard conditions Fig. S13 from Chen et al., 2019
ectoderm cell population proliferation occurrence, ameliorated WT + MO1-klf4 + MO2-klf4 + MO4-tp53 standard conditions Fig 5 with image from Chen et al., 2019
ectoderm cell population proliferation occurrence, ameliorated WT + MO1-cdkn1a + MO1-klf4 + MO2-klf4 standard conditions Fig 5 with image from Chen et al., 2019
Citations