Morpholino

MO1-chd7

ID
ZDB-MRPHLNO-111012-1
Name
MO1-chd7
Previous Names
None
Target
Sequence
5' - TGCAGCCAAGCTTAGAAGCAGGAC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO. Targets the 5'UTR.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-chd7
Expressed Gene Anatomy Figures
cdx1a Fig. 4 with image from Jacobs-McDaniels et al., 2011
cdx4 Fig. S3 with image from Jacobs-McDaniels et al., 2011
dlc Fig. 4 with image from Jacobs-McDaniels et al., 2011
efnb2a Fig. 6 with image from Patten et al., 2012
foxn1 Fig. S9 from Liu et al., 2018
her7 Fig. 4 with image from Jacobs-McDaniels et al., 2011
ikzf1 Fig. S9 from Liu et al., 2018
mespaa Fig. 4 with image from Jacobs-McDaniels et al., 2011
ripply1 Fig. 4 with image from Jacobs-McDaniels et al., 2011
spaw Fig. S2 with image from Jacobs-McDaniels et al., 2011
tbxta Fig. S3 with image from Jacobs-McDaniels et al., 2011
ttn.2 Fig. 6 with image from Patten et al., 2012
Phenotype
Phenotype resulting from MO1-chd7
Phenotype Fish Figures
atrium orientation cardiac ventricle, abnormal AB + MO1-chd7 Fig. 3 with image from Patten et al., 2012
axonogenesis disrupted, abnormal AB + MO1-chd7 Fig. 8 with image from Patten et al., 2012
bone mineralization process quality, abnormal AB + MO1-chd7 Fig. 5 with image from Patten et al., 2012
brain morphology, abnormal AB + MO1-chd7 Fig. 3 with image from Jacobs-McDaniels et al., 2011
branching involved in blood vessel morphogenesis disrupted, abnormal y1Tg + MO1-chd7 Fig. 6 with image from Patten et al., 2012
caudal fin morphology, abnormal AB + MO1-chd7 Fig. 2 with image from Patten et al., 2012
cranial nerve motor neuron disorganized, abnormal AB + MO1-chd7 Fig. 8 with image from Patten et al., 2012
cranial nerve motor neuron position, abnormal AB + MO1-chd7 Fig. 8 with image from Patten et al., 2012
cranial neural crest disorganized, abnormal y1Tg + MO1-chd7 Fig. 9 with image from Patten et al., 2012
cranial neural crest has fewer parts of type cranial neural crest cell, abnormal y1Tg + MO1-chd7 Fig. 9 with image from Patten et al., 2012
determination of left/right symmetry disrupted, abnormal AB + MO1-chd7 Fig. 4 with image,  Fig. S2 with image from Jacobs-McDaniels et al., 2011
eye decreased size, abnormal AB + MO1-chd7 Fig. 2 with image,  Fig. 3 with image from Patten et al., 2012
eye photoreceptor cell absent, abnormal AB + MO1-chd7 Fig. S2 with image from Patten et al., 2012
facial ganglion hypoplastic, abnormal AB + MO1-chd7 Fig. 8 with image from Patten et al., 2012
facial ganglion axon decreased amount, abnormal AB + MO1-chd7 Fig. 8 with image from Patten et al., 2012
facial ganglion axon decreased length, abnormal AB + MO1-chd7 Fig. 8 with image from Patten et al., 2012
facial nerve motor nucleus has fewer parts of type motor neuron, abnormal AB + MO1-chd7 Fig. 8 with image from Patten et al., 2012
head flattened, abnormal AB + MO1-chd7 Fig. 2 with image from Patten et al., 2012
Fig. 3 with image from Jacobs-McDaniels et al., 2011
heart morphology, abnormal AB + MO1-chd7 Fig. 2 with image from Patten et al., 2012
heart tubular, abnormal AB + MO1-chd7 Fig. 3 with image from Patten et al., 2012
heart looping process quality, abnormal AB + MO1-chd7 Fig. 3 with image from Patten et al., 2012
hemal spine decreased size, abnormal AB + MO1-chd7 Fig. 5 with image from Patten et al., 2012
inner ear has fewer parts of type otolith, abnormal AB + MO1-chd7 Fig. 4 with image from Patten et al., 2012
inner ear morphology, abnormal AB + MO1-chd7 Fig. 4 with image from Patten et al., 2012
intersegmental vessel irregular spatial pattern, abnormal y1Tg + MO1-chd7 Fig. 6 with image from Patten et al., 2012
neural crest cell migration disrupted, abnormal y1Tg + MO1-chd7 Fig. 9 with image from Patten et al., 2012
neural crest formation process quality, abnormal y1Tg + MO1-chd7 Fig. 9 with image from Patten et al., 2012
neural spine decreased size, abnormal AB + MO1-chd7 Fig. 5 with image from Patten et al., 2012
otolith increased size, abnormal AB + MO1-chd7 Fig. 4 with image from Patten et al., 2012
otolith increased variability of size, abnormal AB + MO1-chd7 Fig. 4 with image from Patten et al., 2012
otolith shape, abnormal AB + MO1-chd7 Fig. 4 with image from Patten et al., 2012
pericardium edematous, abnormal AB + MO1-chd7 Fig. 3 with image from Patten et al., 2012
Fig. 3 with image from Jacobs-McDaniels et al., 2011
pharyngeal arch decreased amount, abnormal y1Tg + MO1-chd7 Fig. 9 with image from Patten et al., 2012
pharyngeal arch malformed, abnormal y1Tg + MO1-chd7 Fig. 9 with image from Patten et al., 2012
post-vent region truncated, abnormal AB + MO1-chd7 Fig. 3 with image from Jacobs-McDaniels et al., 2011
retina malformed, abnormal AB + MO1-chd7 Fig. 7 with image from Patten et al., 2012
retina layer formation disrupted, abnormal AB + MO1-chd7 Fig. 7 with image from Patten et al., 2012
retinal ganglion cell decreased amount, abnormal AB + MO1-chd7 Fig. 7 with image from Patten et al., 2012
retinal ganglion cell layer disorganized, abnormal AB + MO1-chd7 Fig. 7 with image from Patten et al., 2012
retinal photoreceptor layer aplastic, abnormal AB + MO1-chd7 Fig. 7 with image,  Fig. S2 with image from Patten et al., 2012
semicircular canal malformed, abnormal AB + MO1-chd7 Fig. 4 with image from Patten et al., 2012
somite border malformed, abnormal AB + MO1-chd7 Fig. 6 with image from Patten et al., 2012
somitogenesis disrupted, abnormal AB + MO1-chd7 Fig. 6 with image from Patten et al., 2012
Fig. 4 with image from Jacobs-McDaniels et al., 2011
somitogenesis process quality, abnormal y1Tg + MO1-chd7 Fig. 6 with image from Patten et al., 2012
thymus ikzf1 expression decreased amount, abnormal AB + MO1-chd7 Fig. S9 from Liu et al., 2018
thymus foxn1 expression decreased amount, abnormal AB + MO1-chd7 Fig. S9 from Liu et al., 2018
trigeminal ganglion axon decreased amount, abnormal AB + MO1-chd7 Fig. 8 with image from Patten et al., 2012
trigeminal ganglion axon decreased length, abnormal AB + MO1-chd7 Fig. 8 with image from Patten et al., 2012
trunk anterior-posterior axis curved, abnormal AB + MO1-chd7 Fig. 5 with image from Patten et al., 2012
vertebra decreased size, abnormal AB + MO1-chd7 Fig. 5 with image from Patten et al., 2012
vertebra has fewer parts of type hemal spine, abnormal AB + MO1-chd7 Fig. 5 with image from Patten et al., 2012
vertebra has fewer parts of type neural spine, abnormal AB + MO1-chd7 Fig. 5 with image from Patten et al., 2012
vertebra increased distance vertebra, abnormal AB + MO1-chd7 Fig. 5 with image from Patten et al., 2012
vertebra shape, abnormal AB + MO1-chd7 Fig. 5 with image from Patten et al., 2012
whole organism balance, abnormal AB + MO1-chd7 text only from Patten et al., 2012
whole organism circling, abnormal AB + MO1-chd7 text only from Patten et al., 2012
whole organism anterior-posterior axis curved, abnormal AB + MO1-chd7 Fig. 2 with image,  text only from Patten et al., 2012
Fig. 3 with image from Jacobs-McDaniels et al., 2011
whole organism anterior-posterior axis kinked, abnormal AB + MO1-chd7 Fig. 3 with image from Jacobs-McDaniels et al., 2011
Phenotype of all Fish created by or utilizing MO1-chd7
Phenotype Fish Conditions Figures
heart looping process quality, abnormal AB + MO1-chd7 standard conditions Fig. 3 with image from Patten et al., 2012
cranial nerve motor neuron disorganized, abnormal AB + MO1-chd7 standard conditions Fig. 8 with image from Patten et al., 2012
brain morphology, abnormal AB + MO1-chd7 standard conditions Fig. 3 with image from Jacobs-McDaniels et al., 2011
heart tubular, abnormal AB + MO1-chd7 standard conditions Fig. 3 with image from Patten et al., 2012
vertebra has fewer parts of type hemal spine, abnormal AB + MO1-chd7 standard conditions Fig. 5 with image from Patten et al., 2012
post-vent region truncated, abnormal AB + MO1-chd7 standard conditions Fig. 3 with image from Jacobs-McDaniels et al., 2011
facial nerve motor nucleus has fewer parts of type motor neuron, abnormal AB + MO1-chd7 standard conditions Fig. 8 with image from Patten et al., 2012
hemal spine decreased size, abnormal AB + MO1-chd7 standard conditions Fig. 5 with image from Patten et al., 2012
thymus ikzf1 expression decreased amount, abnormal AB + MO1-chd7 standard conditions Fig. S9 from Liu et al., 2018
cranial nerve motor neuron position, abnormal AB + MO1-chd7 standard conditions Fig. 8 with image from Patten et al., 2012
trigeminal ganglion axon decreased amount, abnormal AB + MO1-chd7 standard conditions Fig. 8 with image from Patten et al., 2012
neural spine decreased size, abnormal AB + MO1-chd7 standard conditions Fig. 5 with image from Patten et al., 2012
trigeminal ganglion axon decreased length, abnormal AB + MO1-chd7 standard conditions Fig. 8 with image from Patten et al., 2012
whole organism anterior-posterior axis curved, abnormal AB + MO1-chd7 standard conditions Fig. 2 with image,  text only from Patten et al., 2012
Fig. 3 with image from Jacobs-McDaniels et al., 2011
axonogenesis disrupted, abnormal AB + MO1-chd7 standard conditions Fig. 8 with image from Patten et al., 2012
retinal ganglion cell decreased amount, abnormal AB + MO1-chd7 standard conditions Fig. 7 with image from Patten et al., 2012
head flattened, abnormal AB + MO1-chd7 standard conditions Fig. 2 with image from Patten et al., 2012
Fig. 3 with image from Jacobs-McDaniels et al., 2011
thymus foxn1 expression decreased amount, abnormal AB + MO1-chd7 standard conditions Fig. S9 from Liu et al., 2018
atrium orientation cardiac ventricle, abnormal AB + MO1-chd7 standard conditions Fig. 3 with image from Patten et al., 2012
whole organism circling, abnormal AB + MO1-chd7 standard conditions text only from Patten et al., 2012
vertebra decreased size, abnormal AB + MO1-chd7 standard conditions Fig. 5 with image from Patten et al., 2012
facial ganglion axon decreased amount, abnormal AB + MO1-chd7 standard conditions Fig. 8 with image from Patten et al., 2012
caudal fin morphology, abnormal AB + MO1-chd7 standard conditions Fig. 2 with image from Patten et al., 2012
determination of left/right symmetry disrupted, abnormal AB + MO1-chd7 standard conditions Fig. 4 with image,  Fig. S2 with image from Jacobs-McDaniels et al., 2011
retinal photoreceptor layer aplastic, abnormal AB + MO1-chd7 standard conditions Fig. 7 with image,  Fig. S2 with image from Patten et al., 2012
retina layer formation disrupted, abnormal AB + MO1-chd7 standard conditions Fig. 7 with image from Patten et al., 2012
semicircular canal malformed, abnormal AB + MO1-chd7 standard conditions Fig. 4 with image from Patten et al., 2012
whole organism balance, abnormal AB + MO1-chd7 standard conditions text only from Patten et al., 2012
retinal ganglion cell layer disorganized, abnormal AB + MO1-chd7 standard conditions Fig. 7 with image from Patten et al., 2012
inner ear morphology, abnormal AB + MO1-chd7 standard conditions Fig. 4 with image from Patten et al., 2012
whole organism anterior-posterior axis kinked, abnormal AB + MO1-chd7 standard conditions Fig. 3 with image from Jacobs-McDaniels et al., 2011
eye photoreceptor cell absent, abnormal AB + MO1-chd7 standard conditions Fig. S2 with image from Patten et al., 2012
pericardium edematous, abnormal AB + MO1-chd7 standard conditions Fig. 3 with image from Patten et al., 2012
Fig. 3 with image from Jacobs-McDaniels et al., 2011
vertebra shape, abnormal AB + MO1-chd7 standard conditions Fig. 5 with image from Patten et al., 2012
facial ganglion axon decreased length, abnormal AB + MO1-chd7 standard conditions Fig. 8 with image from Patten et al., 2012
somite border malformed, abnormal AB + MO1-chd7 standard conditions Fig. 6 with image from Patten et al., 2012
vertebra has fewer parts of type neural spine, abnormal AB + MO1-chd7 standard conditions Fig. 5 with image from Patten et al., 2012
retina malformed, abnormal AB + MO1-chd7 standard conditions Fig. 7 with image from Patten et al., 2012
facial ganglion hypoplastic, abnormal AB + MO1-chd7 standard conditions Fig. 8 with image from Patten et al., 2012
vertebra increased distance vertebra, abnormal AB + MO1-chd7 standard conditions Fig. 5 with image from Patten et al., 2012
otolith increased size, abnormal AB + MO1-chd7 standard conditions Fig. 4 with image from Patten et al., 2012
bone mineralization process quality, abnormal AB + MO1-chd7 standard conditions Fig. 5 with image from Patten et al., 2012
otolith increased variability of size, abnormal AB + MO1-chd7 standard conditions Fig. 4 with image from Patten et al., 2012
otolith shape, abnormal AB + MO1-chd7 standard conditions Fig. 4 with image from Patten et al., 2012
eye decreased size, abnormal AB + MO1-chd7 standard conditions Fig. 2 with image,  Fig. 3 with image from Patten et al., 2012
heart morphology, abnormal AB + MO1-chd7 standard conditions Fig. 2 with image from Patten et al., 2012
trunk anterior-posterior axis curved, abnormal AB + MO1-chd7 standard conditions Fig. 5 with image from Patten et al., 2012
inner ear has fewer parts of type otolith, abnormal AB + MO1-chd7 standard conditions Fig. 4 with image from Patten et al., 2012
somitogenesis disrupted, abnormal AB + MO1-chd7 standard conditions Fig. 6 with image from Patten et al., 2012
Fig. 4 with image from Jacobs-McDaniels et al., 2011
neural crest cell migration disrupted, abnormal y1Tg + MO1-chd7 standard conditions Fig. 9 with image from Patten et al., 2012
neural crest formation process quality, abnormal y1Tg + MO1-chd7 standard conditions Fig. 9 with image from Patten et al., 2012
somitogenesis process quality, abnormal y1Tg + MO1-chd7 standard conditions Fig. 6 with image from Patten et al., 2012
intersegmental vessel irregular spatial pattern, abnormal y1Tg + MO1-chd7 standard conditions Fig. 6 with image from Patten et al., 2012
branching involved in blood vessel morphogenesis disrupted, abnormal y1Tg + MO1-chd7 standard conditions Fig. 6 with image from Patten et al., 2012
cranial neural crest disorganized, abnormal y1Tg + MO1-chd7 standard conditions Fig. 9 with image from Patten et al., 2012
pharyngeal arch malformed, abnormal y1Tg + MO1-chd7 standard conditions Fig. 9 with image from Patten et al., 2012
cranial neural crest has fewer parts of type cranial neural crest cell, abnormal y1Tg + MO1-chd7 standard conditions Fig. 9 with image from Patten et al., 2012
pharyngeal arch decreased amount, abnormal y1Tg + MO1-chd7 standard conditions Fig. 9 with image from Patten et al., 2012
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.