ZFIN ID: ZDB-MRPHLNO-110928-7
Morpholino Name: MO1-ifngr1l
Target: ifngr1l (1)
Previous Names: MO1-crfb13, MO1-ifngr1, MO1-si:ch211-165e15.2

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CAAACCAGGATCTCCAGACATTTTG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-ifngr1l No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-ifngr1l No data available
PHENOTYPE
Phenotype resulting from MO1-ifngr1l
No data available

Phenotype of all Fish created by or utilizing MO1-ifngr1l
Genome Resources:
CITATIONS (2)