Morpholino

MO1-smyd3

ID
ZDB-MRPHLNO-110922-1
Name
MO1-smyd3
Previous Names
None
Target
Sequence
5' - CCTCTCCATAATCACAGCCTCCATC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-smyd3
Expressed Gene Anatomy Figures
chrd Figure 4 with image from Fittipaldi et al., 2021
ckma Fig. 5 with image from Fujii et al., 2011
gata2a Figure 4 with image from Fittipaldi et al., 2021
gata5 Figure 4 with image from Fittipaldi et al., 2021
Fig. 4 with image from Fujii et al., 2011
gata6 Figure 4 with image from Fittipaldi et al., 2021
gsc Figure 4 with image from Fittipaldi et al., 2021
hand2 Fig. 4 with image from Fujii et al., 2011
kdrl Figure 6 with image from Fittipaldi et al., 2021
mespaa Figure 4 with image from Fittipaldi et al., 2021
myf5 Fig. 5 with image from Fujii et al., 2011
myh6 Fig. 4 with image from Fujii et al., 2011
myh7 Fig. 4 with image from Fujii et al., 2011
myl7 Fig. 4 with image from Fujii et al., 2011
mylpfa Fig. 5 with image from Fujii et al., 2011
myod1 Fig. 5 with image from Fujii et al., 2011
myog Fig. 5 with image from Fujii et al., 2011
nkx2.5 Fig. 4 with image from Fujii et al., 2011
smyhc1 Fig. 5 with image from Fujii et al., 2011
sox17 Figure 1 with image from Fittipaldi et al., 2021
tal1 Fig. 4 with image from Fujii et al., 2011
Phenotype
Phenotype resulting from MO1-smyd3
Phenotype Fish Figures
blastoderm gata5 expression increased amount, abnormal AB + MO1-smyd3 Figure 4 with image from Fittipaldi et al., 2021
blastoderm gata6 expression increased amount, abnormal AB + MO1-smyd3 Figure 4 with image from Fittipaldi et al., 2021
blastoderm mespaa expression increased amount, abnormal AB + MO1-smyd3 Figure 4 with image from Fittipaldi et al., 2021
blastoderm gsc expression increased distribution, abnormal AB + MO1-smyd3 Figure 4 with image from Fittipaldi et al., 2021
blastoderm chrd expression increased distribution, abnormal AB + MO1-smyd3 Figure 4 with image from Fittipaldi et al., 2021
caudal vein plexus kdrl expression increased amount, abnormal AB + MO1-smyd3 Figure 6 with image from Fittipaldi et al., 2021
dorsal aorta kdrl expression increased amount, abnormal AB + MO1-smyd3 Figure 6 with image from Fittipaldi et al., 2021
endodermal cell sox17 expression increased amount, abnormal AB + MO1-smyd3 Figure 1 with image from Fittipaldi et al., 2021
heart morphology, abnormal WT + MO1-smyd3 Fig. 2 with image from Fujii et al., 2011
heart development disrupted, abnormal WT + MO1-smyd3 Fig. 2 with image from Fujii et al., 2011
intersegmental vessel kdrl expression increased amount, abnormal AB + MO1-smyd3 Figure 6 with image from Fittipaldi et al., 2021
pericardium edematous, abnormal WT + MO1-smyd3 Fig. 2 with image from Fujii et al., 2011
posterior cardinal vein kdrl expression increased amount, abnormal AB + MO1-smyd3 Figure 6 with image from Fittipaldi et al., 2021
presumptive mesoderm ventral region gata2a expression decreased amount, abnormal AB + MO1-smyd3 Figure 4 with image from Fittipaldi et al., 2021
trunk curved dorsal, abnormal WT + MO1-smyd3 Fig. 2 with image from Fujii et al., 2011
Phenotype of all Fish created by or utilizing MO1-smyd3
Phenotype Fish Conditions Figures
blastoderm gata5 expression increased amount, abnormal AB + MO1-smyd3 standard conditions Figure 4 with image from Fittipaldi et al., 2021
caudal vein plexus kdrl expression increased amount, abnormal AB + MO1-smyd3 standard conditions Figure 6 with image from Fittipaldi et al., 2021
blastoderm chrd expression increased distribution, abnormal AB + MO1-smyd3 standard conditions Figure 4 with image from Fittipaldi et al., 2021
endodermal cell sox17 expression increased amount, abnormal AB + MO1-smyd3 standard conditions Figure 1 with image from Fittipaldi et al., 2021
presumptive mesoderm ventral region gata2a expression decreased amount, abnormal AB + MO1-smyd3 standard conditions Figure 4 with image from Fittipaldi et al., 2021
blastoderm gsc expression increased distribution, abnormal AB + MO1-smyd3 standard conditions Figure 4 with image from Fittipaldi et al., 2021
posterior cardinal vein kdrl expression increased amount, abnormal AB + MO1-smyd3 standard conditions Figure 6 with image from Fittipaldi et al., 2021
blastoderm gata6 expression increased amount, abnormal AB + MO1-smyd3 standard conditions Figure 4 with image from Fittipaldi et al., 2021
dorsal aorta kdrl expression increased amount, abnormal AB + MO1-smyd3 standard conditions Figure 6 with image from Fittipaldi et al., 2021
intersegmental vessel kdrl expression increased amount, abnormal AB + MO1-smyd3 standard conditions Figure 6 with image from Fittipaldi et al., 2021
blastoderm mespaa expression increased amount, abnormal AB + MO1-smyd3 standard conditions Figure 4 with image from Fittipaldi et al., 2021
heart morphology, abnormal WT + MO1-smyd3 standard conditions Fig. 2 with image from Fujii et al., 2011
trunk curved dorsal, abnormal WT + MO1-smyd3 standard conditions Fig. 2 with image from Fujii et al., 2011
pericardium edematous, abnormal WT + MO1-smyd3 standard conditions Fig. 2 with image from Fujii et al., 2011
heart development disrupted, abnormal WT + MO1-smyd3 standard conditions Fig. 2 with image from Fujii et al., 2011
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.