Morpholino

MO3-wnt2

ID
ZDB-MRPHLNO-110916-6
Name
MO3-wnt2
Previous Names
  • MO acc-wnt2 (1)
Target
Sequence
5' - GCCCATGTACCTGCATAAAGAGATG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking Morpholino.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-wnt2
Expressed Gene Anatomy Figures
cp Fig. 2 with image from Poulain et al., 2011
foxa1 Fig. 6 with image from Poulain et al., 2011
hhex Fig. 2 with image from Poulain et al., 2011
ins Fig. 1 with image from Poulain et al., 2011
Phenotype
Phenotype resulting from MO3-wnt2
Phenotype Fish Figures
liver decreased size, abnormal jh1Tg + MO3-wnt2 Fig. 1 with image,  Fig. 2 with image from Poulain et al., 2011
liver hypoplastic, abnormal s854Tg + MO3-wnt2 Fig. 1 with image from Poulain et al., 2011
liver development having decreased processual parts cell population proliferation, abnormal s854Tg + MO3-wnt2 Fig. 1 with image from Poulain et al., 2011
pancreatic B cell mislocalised, abnormal s854Tg + MO3-wnt2 Fig. 1 with image from Poulain et al., 2011
swim bladder decreased size, abnormal WT + MO3-wnt2 Fig. 6 with image from Poulain et al., 2011
swim bladder development having decreased processual parts cell population proliferation, abnormal WT + MO3-wnt2 Fig. 6 with image from Poulain et al., 2011
Phenotype of all Fish created by or utilizing MO3-wnt2
Phenotype Fish Conditions Figures
swim bladder decreased size, abnormal WT + MO3-wnt2 standard conditions Fig. 6 with image from Poulain et al., 2011
swim bladder development having decreased processual parts cell population proliferation, abnormal WT + MO3-wnt2 standard conditions Fig. 6 with image from Poulain et al., 2011
liver decreased size, abnormal WT + MO3-wnt2 standard conditions Fig. 2 with image from Poulain et al., 2011
liver decreased size, abnormal jh1Tg + MO3-wnt2 standard conditions Fig. 1 with image from Poulain et al., 2011
liver hypoplastic, abnormal jh1Tg + MO3-wnt2 standard conditions Fig. 1 with image from Poulain et al., 2011
liver development having decreased processual parts cell population proliferation, abnormal jh1Tg + MO3-wnt2 standard conditions Fig. 1 with image from Poulain et al., 2011
liver decreased size, abnormal s854Tg + MO3-wnt2 standard conditions Fig. 1 with image,  Fig. 2 with image from Poulain et al., 2011
liver hypoplastic, abnormal s854Tg + MO3-wnt2 standard conditions Fig. 1 with image from Poulain et al., 2011
pancreatic B cell mislocalised, abnormal s854Tg + MO3-wnt2 standard conditions Fig. 1 with image from Poulain et al., 2011
liver development having decreased processual parts cell population proliferation, abnormal s854Tg + MO3-wnt2 standard conditions Fig. 1 with image from Poulain et al., 2011
liver decreased size, abnormal gz2Tg; gz4Tg; s854Tg + MO3-wnt2 standard conditions Fig. 2 with image from Poulain et al., 2011
liver decreased size, abnormal wnt2bbs403/s403 + MO3-wnt2 standard conditions Fig. 2 with image from Poulain et al., 2011
swim bladder development having decreased processual parts cell population proliferation, abnormal wnt2bbs403/s403 + MO3-wnt2 standard conditions Fig. 6 with image from Poulain et al., 2011
swim bladder absent, abnormal wnt2bbs403/s403 + MO3-wnt2 standard conditions Fig. 6 with image from Poulain et al., 2011
liver absent, abnormal wnt2bbs403/s403 + MO3-wnt2 standard conditions Fig. 2 with image,  Fig. 6 with image from Poulain et al., 2011
swim bladder development having decreased processual parts cell population proliferation, abnormal wnt2bbs404/s404 + MO3-wnt2 standard conditions Fig. 6 with image from Poulain et al., 2011
swim bladder absent, abnormal wnt2bbs404/s404 + MO3-wnt2 standard conditions Fig. 6 with image from Poulain et al., 2011
liver absent, abnormal wnt2bbs404/s404 + MO3-wnt2 standard conditions Fig. 2 with image,  Fig. 6 with image from Poulain et al., 2011
liver decreased size, abnormal wnt2bbs404/s404 + MO3-wnt2 standard conditions Fig. 2 with image from Poulain et al., 2011
liver decreased size, abnormal WT + MO1-fzd5 + MO3-wnt2 standard conditions Fig. 5 with image from Poulain et al., 2011
gall bladder absent, abnormal wnt2bbs403/s403; gz2Tg; gz4Tg; s854Tg + MO3-wnt2 standard conditions Fig. 2 with image from Poulain et al., 2011
liver development having decreased processual parts cell population proliferation, abnormal wnt2bbs403/s403; gz2Tg; gz4Tg; s854Tg + MO3-wnt2 standard conditions Fig. 2 with image from Poulain et al., 2011
gall bladder decreased size, abnormal wnt2bbs403/s403; gz2Tg; gz4Tg; s854Tg + MO3-wnt2 standard conditions Fig. 2 with image from Poulain et al., 2011
extrahepatic duct decreased size, abnormal wnt2bbs403/s403; gz2Tg; gz4Tg; s854Tg + MO3-wnt2 standard conditions Fig. 2 with image from Poulain et al., 2011
extrahepatic duct absent, abnormal wnt2bbs403/s403; gz2Tg; gz4Tg; s854Tg + MO3-wnt2 standard conditions Fig. 2 with image from Poulain et al., 2011
liver absent, abnormal wnt2bbs403/s403; gz2Tg; gz4Tg; s854Tg + MO3-wnt2 standard conditions Fig. 2 with image from Poulain et al., 2011
liver decreased size, abnormal wnt2bbs403/s403; s854Tg + MO3-wnt2 standard conditions Fig. 2 with image from Poulain et al., 2011
liver hypoplastic, abnormal wnt2bbs403/s403; s854Tg + MO3-wnt2 standard conditions Fig. 2 with image from Poulain et al., 2011
liver development having decreased processual parts cell population proliferation, abnormal wnt2bbs403/s403; s854Tg + MO3-wnt2 standard conditions Fig. 2 with image from Poulain et al., 2011
extrahepatic duct decreased size, abnormal wnt2bbs403/s403; s854Tg + MO3-wnt2 standard conditions Fig. 2 with image from Poulain et al., 2011
liver development having decreased processual parts cell population proliferation, abnormal wnt2bbs404/s404; gz2Tg; gz4Tg; s854Tg + MO3-wnt2 standard conditions Fig. 2 with image from Poulain et al., 2011
liver absent, abnormal wnt2bbs404/s404; gz2Tg; gz4Tg; s854Tg + MO3-wnt2 standard conditions Fig. 2 with image from Poulain et al., 2011
extrahepatic duct decreased size, abnormal wnt2bbs404/s404; gz2Tg; gz4Tg; s854Tg + MO3-wnt2 standard conditions Fig. 2 with image from Poulain et al., 2011
gall bladder absent, abnormal wnt2bbs404/s404; gz2Tg; gz4Tg; s854Tg + MO3-wnt2 standard conditions Fig. 2 with image from Poulain et al., 2011
gall bladder decreased size, abnormal wnt2bbs404/s404; gz2Tg; gz4Tg; s854Tg + MO3-wnt2 standard conditions Fig. 2 with image from Poulain et al., 2011
extrahepatic duct absent, abnormal wnt2bbs404/s404; gz2Tg; gz4Tg; s854Tg + MO3-wnt2 standard conditions Fig. 2 with image from Poulain et al., 2011
liver absent, abnormal wnt2bbs404/s404; s854Tg + MO3-wnt2 standard conditions Fig. 2 with image from Poulain et al., 2011
extrahepatic duct decreased size, abnormal wnt2bbs404/s404; s854Tg + MO3-wnt2 standard conditions Fig. 2 with image from Poulain et al., 2011
liver decreased size, abnormal wnt2bbs404/s404; s854Tg + MO3-wnt2 standard conditions Fig. 2 with image from Poulain et al., 2011
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.