Morpholino
MO2-lin28ab
- ID
- ZDB-MRPHLNO-110913-2
- Name
- MO2-lin28ab
- Previous Names
-
- MO2-lin28a
- Target
- Sequence
-
5' - ACTAGGCCATACAATTAACTGCTTT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Targets the 5'UTR.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-lin28ab
No data available
Phenotype
Phenotype resulting from MO2-lin28ab
No data available
Phenotype of all Fish created by or utilizing MO2-lin28ab
No data available
Citations
- Nelson, C.M., Ackerman, K.M., O'Hayer, P., Bailey, T.J., Gorsuch, R.A., and Hyde, D.R. (2013) Tumor Necrosis Factor-Alpha Is Produced by Dying Retinal Neurons and Is Required for Muller Glia Proliferation during Zebrafish Retinal Regeneration. The Journal of neuroscience : the official journal of the Society for Neuroscience. 33(15):6524-6539
- Nelson, C.M., Gorsuch, R.A., Bailey, T.J., Ackerman, K.M., Kassen, S.C., and Hyde, D.R. (2012) Stat3 defines three populations of Müller glia and is required for initiating maximal Müller glia proliferation in the regenerating zebrafish retina. The Journal of comparative neurology. 520(18):4294-4311
- Powell, C., Elsaeidi, F., and Goldman, D. (2012) Injury-Dependent Muller Glia and Ganglion Cell Reprogramming during Tissue Regeneration Requires Apobec2a and Apobec2b. The Journal of neuroscience : the official journal of the Society for Neuroscience. 32(3):1096-1109
- Ramachandran, R., Zhao, X.F., and Goldman, D. (2011) Ascl1a/Dkk/ beta -catenin signaling pathway is necessary and glycogen synthase kinase-3 beta inhibition is sufficient for zebrafish retina regeneration. Proceedings of the National Academy of Sciences of the United States of America. 108(38):15858-63
- Ramachandran, R., Fausett, B.V., and Goldman, D. (2010) Ascl1a regulates Müller glia dedifferentiation and retinal regeneration through a Lin-28-dependent, let-7 microRNA signalling pathway. Nature cell biology. 12(11):1101-1107
1 - 5 of 5
Show