Community Action Needed: Please respond to the NIH RFI
Morpholino

MO1-nphp1

ID
ZDB-MRPHLNO-110908-3
Name
MO1-nphp1
Previous Names
  • nphp1 ATG (1)
  • MO1-zgc:152930
Target
Sequence
5' - CCCTCTTCTCTTTGGAGGCATGTTG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-nphp1
No data available
Phenotype
Phenotype resulting from MO1-nphp1
Phenotype of all Fish created by or utilizing MO1-nphp1
Phenotype Fish Conditions Figures
somite increased width, abnormal WT + MO1-nphp1 standard conditions Fig. S1 from Lindstrand et al., 2014
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-nphp1 standard conditions Fig. S1 from Lindstrand et al., 2014
notochord kinked, abnormal WT + MO1-nphp1 standard conditions Fig. S1 from Lindstrand et al., 2014
notochord increased width, abnormal WT + MO1-nphp1 standard conditions Fig. S1 from Lindstrand et al., 2014
convergent extension process quality, abnormal WT + MO1-nphp1 standard conditions Fig. S1 from Lindstrand et al., 2014
whole organism curved ventral, abnormal li1Tg + MO1-nphp1 + MO4-tp53 standard conditions Fig. 6 from Slanchev et al., 2011
pronephros cystic, abnormal li1Tg + MO1-nphp1 + MO4-tp53 standard conditions Fig. 2 with image from Viau et al., 2018
cloaca development disrupted, abnormal zf106Tg + MO1-nphp1 + MO4-tp53 standard conditions Fig. S3 from Slanchev et al., 2011
ventral fin fold absent, abnormal zf106Tg + MO1-nphp1 + MO4-tp53 standard conditions Fig. S3 from Slanchev et al., 2011
pronephric duct decreased length, abnormal zf106Tg + MO1-nphp1 + MO4-tp53 standard conditions Fig. S3 from Slanchev et al., 2011
cloacal chamber distended, abnormal zf106Tg + MO1-nphp1 + MO4-tp53 standard conditions Fig. S3 from Slanchev et al., 2011
pronephric duct cilium disoriented, abnormal li1Tg + MO1-nphp1 + MO3-nphp4 + MO4-tp53 standard conditions Fig. 6 from Slanchev et al., 2011
heart tube left side of axis, abnormal li1Tg + MO1-nphp1 + MO3-nphp4 + MO4-tp53 standard conditions Fig. 6 from Slanchev et al., 2011
pronephric duct dilated, abnormal li1Tg + MO1-nphp1 + MO3-nphp4 + MO4-tp53 standard conditions Fig. 6 from Slanchev et al., 2011
whole organism curved ventral, abnormal li1Tg + MO1-nphp1 + MO3-nphp4 + MO4-tp53 standard conditions Fig. 6 from Slanchev et al., 2011
heart tube centered, abnormal li1Tg + MO1-nphp1 + MO3-nphp4 + MO4-tp53 standard conditions Fig. 6 from Slanchev et al., 2011
pericardium edematous, abnormal li1Tg + MO1-nphp1 + MO3-nphp4 + MO4-tp53 standard conditions Fig. 6 from Slanchev et al., 2011
pronephros cystic, abnormal li1Tg + MO1-nphp1 + MO3-nphp4 + MO4-tp53 standard conditions Fig. 6 from Slanchev et al., 2011
pronephros cystic, exacerbated li1Tg + MO1-nphp1 + MO3-stk11 + MO4-tp53 standard conditions Fig. 2 with image from Viau et al., 2018
Citations