Morpholino

MO2-ulk2

ID
ZDB-MRPHLNO-110825-3
Name
MO2-ulk2
Previous Names
  • ulk2 MO spl (1)
Target
Sequence
5' - TCGGCTGTTAAACAAAGAGAGCGCC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
splice-blocker targeted to to a splice acceptor site at the beginning of exon 7, resulting in deletion of exon 7 and a frameshift-induced stop codon in exon 8.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-ulk2
No data available
Phenotype
Phenotype resulting from MO2-ulk2
Phenotype of all Fish created by or utilizing MO2-ulk2
Phenotype Fish Conditions Figures
dorsal habenular nucleus dendrite decreased volume, abnormal AB + MO2-ulk2 standard conditions Fig. 9 from Taylor et al., 2011
habenula dendrite decreased volume, abnormal AB + MO2-ulk2 standard conditions Fig. 4 from Taylor et al., 2011
regulation of dendrite morphogenesis process quality, abnormal AB + MO2-ulk2 standard conditions Fig. 4Fig. 9 from Taylor et al., 2011
habenula development process quality, abnormal AB + MO2-ulk2 standard conditions Fig. 4Fig. 9 from Taylor et al., 2011
habenula dendrite absent, abnormal AB + MO2-ulk2 standard conditions Fig. 4 from Taylor et al., 2011
ventral habenular nucleus dendrite decreased volume, abnormal AB + MO2-ulk2 standard conditions Fig. 9 from Taylor et al., 2011
habenula development disrupted, abnormal WT + MO2-ulk2 standard conditions Fig. 6 with image from Colombo et al., 2013
habenula dendrite decreased volume, abnormal WT + MO2-ulk2 standard conditions Fig. 6 with image from Colombo et al., 2013
dendrite morphogenesis disrupted, abnormal WT + MO2-ulk2 standard conditions Fig. 6 with image from Colombo et al., 2013
habenula dendrite arborization process quality, abnormal s1019tEt + MO2-ulk2 control Fig. 3 from Lee et al., 2014
habenula dendrite decreased branchiness, abnormal s1019tEt + MO2-ulk2 control Fig. 2 from Lee et al., 2014
habenula development disrupted, abnormal WT + MO2-daam1a + MO2-ulk2 standard conditions Fig. 6 with image from Colombo et al., 2013
dendrite morphogenesis disrupted, abnormal WT + MO2-daam1a + MO2-ulk2 standard conditions Fig. 6 with image from Colombo et al., 2013
habenula dendrite decreased volume, abnormal WT + MO2-daam1a + MO2-ulk2 standard conditions Fig. 6 with image from Colombo et al., 2013
dorsal habenular nucleus dendrite decreased volume, abnormal kctd12.1vu442Tg/vu442Tg + MO2-ulk2 (AB) standard conditions Fig. 9 from Taylor et al., 2011
regulation of dendrite morphogenesis process quality, abnormal kctd12.1vu442Tg/vu442Tg + MO2-ulk2 (AB) standard conditions Fig. 9 from Taylor et al., 2011
habenula development process quality, abnormal kctd12.1vu442Tg/vu442Tg + MO2-ulk2 (AB) standard conditions Fig. 9 from Taylor et al., 2011
Citations