Morpholino

MO3-hmgb1a

ID
ZDB-MRPHLNO-110729-7
Name
MO3-hmgb1a
Previous Names
None
Target
Sequence
5' - CCTTCCCCATCTTTGCCTAAATATC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-hmgb1a
Expressed Gene Anatomy Figures
amigo1 Fig. 3 from Zhao et al., 2011
hmgb1a Fig. 3 from Zhao et al., 2011
pax6a Fig. 5 from Zhao et al., 2011
Phenotype
Phenotype resulting from MO3-hmgb1a
Phenotype Fish Figures
apoptotic process increased occurrence, abnormal WT + MO3-hmgb1a Fig. 5 from Zhao et al., 2011
brain decreased width, abnormal WT + MO3-hmgb1a Fig. 4 from Zhao et al., 2011
canonical Wnt signaling pathway increased process quality, abnormal WT + MO3-hmgb1a Fig. 7 from Zhao et al., 2011
dopaminergic neuron decreased amount, abnormal WT + MO3-hmgb1a Fig. 4 from Zhao et al., 2011
eye decreased distance eye, abnormal WT + MO3-hmgb1a Fig. 4,  Fig. S7 from Zhao et al., 2011
forebrain neuromere disheveled, abnormal WT + MO3-hmgb1a Fig. S7 from Zhao et al., 2011
post-vent region curved, abnormal WT + MO3-hmgb1a Fig. 4 from Zhao et al., 2011
telencephalon decreased size, abnormal WT + MO3-hmgb1a Fig. S7 from Zhao et al., 2011
third ventricle compartment boundary inconspicuous, abnormal WT + MO3-hmgb1a Fig. S7 from Zhao et al., 2011
whole organism decreased size, abnormal WT + MO3-hmgb1a Fig. 4 from Zhao et al., 2011
whole organism immobile, abnormal WT + MO3-hmgb1a Fig. 4 from Zhao et al., 2011
Phenotype of all Fish created by or utilizing MO3-hmgb1a
Phenotype Fish Conditions Figures
brain decreased width, abnormal WT + MO3-hmgb1a standard conditions Fig. 4 from Zhao et al., 2011
dopaminergic neuron decreased amount, abnormal WT + MO3-hmgb1a standard conditions Fig. 4 from Zhao et al., 2011
forebrain neuromere disheveled, abnormal WT + MO3-hmgb1a standard conditions Fig. S7 from Zhao et al., 2011
whole organism immobile, abnormal WT + MO3-hmgb1a standard conditions Fig. 4 from Zhao et al., 2011
post-vent region curved, abnormal WT + MO3-hmgb1a standard conditions Fig. 4 from Zhao et al., 2011
telencephalon decreased size, abnormal WT + MO3-hmgb1a standard conditions Fig. S7 from Zhao et al., 2011
eye decreased distance eye, abnormal WT + MO3-hmgb1a standard conditions Fig. 4,  Fig. S7 from Zhao et al., 2011
third ventricle compartment boundary inconspicuous, abnormal WT + MO3-hmgb1a standard conditions Fig. S7 from Zhao et al., 2011
apoptotic process increased occurrence, abnormal WT + MO3-hmgb1a standard conditions Fig. 5 from Zhao et al., 2011
whole organism decreased size, abnormal WT + MO3-hmgb1a standard conditions Fig. 4 from Zhao et al., 2011
canonical Wnt signaling pathway increased process quality, abnormal WT + MO3-hmgb1a standard conditions Fig. 7 from Zhao et al., 2011
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.