Morpholino

MO2-ctsd

ID
ZDB-MRPHLNO-110722-2
Name
MO2-ctsd
Previous Names
  • S-MPO (1)
Target
Sequence
5' - TGTCAGCAAGCAGATACTCACATCT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
View all 3 target locations
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-ctsd
Expressed Gene Anatomy Figures
ctsd Fig. 9 with image from Follo et al., 2011
Phenotype
Phenotype resulting from MO2-ctsd
No data available
Phenotype of all Fish created by or utilizing MO2-ctsd
No data available
Citations