Morpholino
MO1-esco2
- ID
- ZDB-MRPHLNO-110713-1
- Name
- MO1-esco2
- Previous Names
-
- esco2_ATG_MO (1)
- Target
- Sequence
-
5' - CTCTTTCGGGATAACATCTTCAATC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-esco2
Expressed Gene | Anatomy | Figures |
---|---|---|
crestin |
Fig. S3 ![]() |
|
dlx2a |
Fig. S3 ![]() |
|
mdm2 |
Fig. 6 ![]() |
|
myca |
Fig. 6 ![]() |
|
runx1 |
Fig. S6 ![]() |
1 - 5 of 7 Show all
Phenotype
Phenotype resulting from MO1-esco2
1 - 5 of 29 Show all
Phenotype of all Fish created by or utilizing MO1-esco2
1 - 5 of 40 Show all
Citations
- Banerji, R., Skibbens, R.V., Iovine, M.K. (2017) Cohesin mediates Esco2-dependent transcriptional regulation in zebrafish regenerating fin model of Roberts syndrome. Biology Open. 6(12):1802-1813
- Banerji, R., Eble, D.M., Iovine, M.K., Skibbens, R.V. (2016) Esco2 regulates cx43 expression during skeletal regeneration in the zebrafish fin. Developmental Dynamics : an official publication of the American Association of Anatomists. 245(1):7-21
- Xu, B., Lee, K.K., Zhang, L., and Gerton, J.L. (2013) Stimulation of mTORC1 with L-leucine Rescues Defects Associated with Roberts Syndrome. PLoS Genetics. 9(10):e1003857
- Mönnich, M., Kuriger, Z., Print, C.G., and Horsfield, J.A. (2011) A zebrafish model of Roberts syndrome reveals that Esco2 depletion interferes with development by disrupting the cell cycle. PLoS One. 6(5):e20051
1 - 4 of 4
Show