Morpholino

MO1-grk5l

ID
ZDB-MRPHLNO-110706-1
Name
MO1-grk5l
Previous Names
  • GRK5 MO (1)
Target
Sequence
5' - ATCCAAAGAATAGATACAGCTCCTG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO. Targets the 5'UTR.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-grk5l
Expressed Gene Anatomy Figures
bmp4 Fig. 1 with image,  Fig. 2 with image from Burkhalter et al., 2013
grk5l Fig. S1 with image from Burkhalter et al., 2013
gsc Fig. 3 with image from Burkhalter et al., 2013
ins Fig. 5 with image from Lessel et al., 2016
Fig. 2 with image from Burkhalter et al., 2013
kdrl Fig. 1 with image from Burkhalter et al., 2013
lft1 Fig. 2 with image from Burkhalter et al., 2013
lft2 Fig. 2 with image from Burkhalter et al., 2013
myh6 Fig. 1 with image from Burkhalter et al., 2013
myh7 Fig. 1 with image from Burkhalter et al., 2013
myl7 Fig. 5 with image from Lessel et al., 2016
Fig. 1 with image,  Fig. S1 with image from Burkhalter et al., 2013
notch1b Fig. 1 with image from Burkhalter et al., 2013
pax2a Fig. 3 with image from Burkhalter et al., 2013
pitx2 Fig. 2 with image from Burkhalter et al., 2013
sox17 Fig. 3 with image from Burkhalter et al., 2013
spaw Fig. 5 with image from Lessel et al., 2016
Fig. 2 with image from Burkhalter et al., 2013
tbxta Fig. 3 with image from Burkhalter et al., 2013
vcana Fig. 1 with image from Burkhalter et al., 2013
Phenotype
Phenotype resulting from MO1-grk5l
Phenotype Fish Figures
cilium assembly process quality, abnormal WT + MO1-grk5l Fig. 3 with image from Burkhalter et al., 2013
determination of heart left/right asymmetry decreased process quality, abnormal WT + MO1-grk5l Fig. 2 with image from Burkhalter et al., 2013
determination of left/right symmetry decreased process quality, abnormal WT + MO1-grk5l Fig. 2 with image,  Fig. 4 with image from Burkhalter et al., 2013
determination of left/right symmetry disrupted, abnormal AB + MO1-grk5l Fig. 5 with image from Lessel et al., 2016
determination of pancreatic left/right asymmetry disrupted, abnormal AB + MO1-grk5l Fig. 5 with image from Lessel et al., 2016
diencephalon bilateral symmetry, abnormal WT + MO1-grk5l Fig. 2 with image from Burkhalter et al., 2013
heart bilateral symmetry, abnormal WT + MO1-grk5l Fig. 2 with image from Burkhalter et al., 2013
heart dilated, abnormal WT + MO1-grk5l Fig. 1 with image from Burkhalter et al., 2013
heart edematous, abnormal WT + MO1-grk5l Fig. 1 with image,  Fig. S1 with image from Burkhalter et al., 2013
heart malformed, abnormal WT + MO1-grk5l Fig. 1 with image from Burkhalter et al., 2013
heart looping decreased process quality, abnormal WT + MO1-grk5l Fig. 1 with image,  Fig. 3 with image from Burkhalter et al., 2013
heart looping disrupted, abnormal AB + MO1-grk5l Fig. 5 with image from Lessel et al., 2016
Kupffer's vesicle motile cilium increased length, abnormal WT + MO1-grk5l Fig. 3 with image from Burkhalter et al., 2013
Kupffer's vesicle development decreased process quality, abnormal WT + MO1-grk5l Fig. 3 with image from Burkhalter et al., 2013
pancreas primordium mislocalised, abnormal WT + MO1-grk5l Fig. 2 with image,  Fig. 3 with image from Burkhalter et al., 2013
post-vent region curled, abnormal WT + MO1-grk5l Fig. S1 with image from Burkhalter et al., 2013
pronephric duct motile cilium increased length, abnormal WT + MO1-grk5l Fig. 3 with image from Burkhalter et al., 2013
TOR signaling increased occurrence, abnormal WT + MO1-grk5l Fig. 4 with image from Burkhalter et al., 2013
Phenotype of all Fish created by or utilizing MO1-grk5l
Phenotype Fish Conditions Figures
heart looping disrupted, abnormal AB + MO1-grk5l standard conditions Fig. 5 with image from Lessel et al., 2016
determination of pancreatic left/right asymmetry disrupted, abnormal AB + MO1-grk5l standard conditions Fig. 5 with image from Lessel et al., 2016
determination of left/right symmetry disrupted, abnormal AB + MO1-grk5l standard conditions Fig. 5 with image from Lessel et al., 2016
heart malformed, abnormal WT + MO1-grk5l standard conditions Fig. 1 with image from Burkhalter et al., 2013
Kupffer's vesicle development decreased process quality, abnormal WT + MO1-grk5l standard conditions Fig. 3 with image from Burkhalter et al., 2013
determination of heart left/right asymmetry decreased process quality, abnormal WT + MO1-grk5l standard conditions Fig. 2 with image from Burkhalter et al., 2013
post-vent region curled, abnormal WT + MO1-grk5l standard conditions Fig. S1 with image from Burkhalter et al., 2013
determination of left/right symmetry decreased process quality, abnormal WT + MO1-grk5l standard conditions Fig. 2 with image,  Fig. 4 with image from Burkhalter et al., 2013
cilium assembly process quality, abnormal WT + MO1-grk5l standard conditions Fig. 3 with image from Burkhalter et al., 2013
TOR signaling increased occurrence, abnormal WT + MO1-grk5l standard conditions Fig. 4 with image from Burkhalter et al., 2013
pancreas primordium mislocalised, abnormal WT + MO1-grk5l standard conditions Fig. 2 with image,  Fig. 3 with image from Burkhalter et al., 2013
heart edematous, abnormal WT + MO1-grk5l standard conditions Fig. 1 with image,  Fig. S1 with image from Burkhalter et al., 2013
diencephalon bilateral symmetry, abnormal WT + MO1-grk5l standard conditions Fig. 2 with image from Burkhalter et al., 2013
heart dilated, abnormal WT + MO1-grk5l standard conditions Fig. 1 with image from Burkhalter et al., 2013
heart bilateral symmetry, abnormal WT + MO1-grk5l standard conditions Fig. 2 with image from Burkhalter et al., 2013
Kupffer's vesicle motile cilium increased length, abnormal WT + MO1-grk5l standard conditions Fig. 3 with image from Burkhalter et al., 2013
pronephric duct motile cilium increased length, abnormal WT + MO1-grk5l standard conditions Fig. 3 with image from Burkhalter et al., 2013
heart looping decreased process quality, abnormal WT + MO1-grk5l standard conditions Fig. 1 with image,  Fig. 3 with image from Burkhalter et al., 2013
heart malformed, abnormal WT + MO1-grk5 + MO1-grk5l standard conditions Fig. S1 with image from Burkhalter et al., 2013
heart looping decreased process quality, abnormal WT + MO1-grk5 + MO1-grk5l standard conditions Fig. S1 with image from Burkhalter et al., 2013
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.