Morpholino

MO1-grk5l

ID
ZDB-MRPHLNO-110706-1
Name
MO1-grk5l
Previous Names
  • GRK5 MO (1)
Target
Sequence
5' - ATCCAAAGAATAGATACAGCTCCTG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO. Targets the 5'UTR.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-grk5l
No data available
Phenotype
Phenotype resulting from MO1-grk5l
Phenotype Fish Figures
cilium assembly process quality, abnormal WT + MO1-grk5l Fig. 3 with image from Burkhalter et al., 2013
determination of heart left/right asymmetry decreased process quality, abnormal WT + MO1-grk5l Fig. 2 with image from Burkhalter et al., 2013
determination of left/right symmetry decreased process quality, abnormal WT + MO1-grk5l Fig. 2 with imageFig. 4 with image from Burkhalter et al., 2013
determination of left/right symmetry disrupted, abnormal AB + MO1-grk5l Fig. 5 with image from Lessel et al., 2016
determination of pancreatic left/right asymmetry disrupted, abnormal AB + MO1-grk5l Fig. 5 with image from Lessel et al., 2016
diencephalon bilateral symmetry, abnormal WT + MO1-grk5l Fig. 2 with image from Burkhalter et al., 2013
heart bilateral symmetry, abnormal WT + MO1-grk5l Fig. 2 with image from Burkhalter et al., 2013
heart dilated, abnormal WT + MO1-grk5l Fig. 1 with image from Burkhalter et al., 2013
heart edematous, abnormal WT + MO1-grk5l Fig. 1 with imageFig. S1 with image from Burkhalter et al., 2013
heart malformed, abnormal WT + MO1-grk5l Fig. 1 with image from Burkhalter et al., 2013
heart looping decreased process quality, abnormal WT + MO1-grk5l Fig. 1 with imageFig. 3 with image from Burkhalter et al., 2013
heart looping disrupted, abnormal AB + MO1-grk5l Fig. 5 with image from Lessel et al., 2016
Kupffer's vesicle motile cilium increased length, abnormal WT + MO1-grk5l Fig. 3 with image from Burkhalter et al., 2013
Kupffer's vesicle development decreased process quality, abnormal WT + MO1-grk5l Fig. 3 with image from Burkhalter et al., 2013
pancreas primordium mislocalised, abnormal WT + MO1-grk5l Fig. 2 with imageFig. 3 with image from Burkhalter et al., 2013
post-vent region curled, abnormal WT + MO1-grk5l Fig. S1 with image from Burkhalter et al., 2013
pronephric duct motile cilium increased length, abnormal WT + MO1-grk5l Fig. 3 with image from Burkhalter et al., 2013
TOR signaling increased occurrence, abnormal WT + MO1-grk5l Fig. 4 with image from Burkhalter et al., 2013
Phenotype of all Fish created by or utilizing MO1-grk5l
Phenotype Fish Conditions Figures
heart looping disrupted, abnormal AB + MO1-grk5l standard conditions Fig. 5 with image from Lessel et al., 2016
determination of pancreatic left/right asymmetry disrupted, abnormal AB + MO1-grk5l standard conditions Fig. 5 with image from Lessel et al., 2016
determination of left/right symmetry disrupted, abnormal AB + MO1-grk5l standard conditions Fig. 5 with image from Lessel et al., 2016
Kupffer's vesicle development decreased process quality, abnormal WT + MO1-grk5l standard conditions Fig. 3 with image from Burkhalter et al., 2013
heart malformed, abnormal WT + MO1-grk5l standard conditions Fig. 1 with image from Burkhalter et al., 2013
determination of heart left/right asymmetry decreased process quality, abnormal WT + MO1-grk5l standard conditions Fig. 2 with image from Burkhalter et al., 2013
post-vent region curled, abnormal WT + MO1-grk5l standard conditions Fig. S1 with image from Burkhalter et al., 2013
determination of left/right symmetry decreased process quality, abnormal WT + MO1-grk5l standard conditions Fig. 2 with imageFig. 4 with image from Burkhalter et al., 2013
cilium assembly process quality, abnormal WT + MO1-grk5l standard conditions Fig. 3 with image from Burkhalter et al., 2013
TOR signaling increased occurrence, abnormal WT + MO1-grk5l standard conditions Fig. 4 with image from Burkhalter et al., 2013
pancreas primordium mislocalised, abnormal WT + MO1-grk5l standard conditions Fig. 2 with imageFig. 3 with image from Burkhalter et al., 2013
heart edematous, abnormal WT + MO1-grk5l standard conditions Fig. 1 with imageFig. S1 with image from Burkhalter et al., 2013
diencephalon bilateral symmetry, abnormal WT + MO1-grk5l standard conditions Fig. 2 with image from Burkhalter et al., 2013
heart dilated, abnormal WT + MO1-grk5l standard conditions Fig. 1 with image from Burkhalter et al., 2013
heart bilateral symmetry, abnormal WT + MO1-grk5l standard conditions Fig. 2 with image from Burkhalter et al., 2013
Kupffer's vesicle motile cilium increased length, abnormal WT + MO1-grk5l standard conditions Fig. 3 with image from Burkhalter et al., 2013
pronephric duct motile cilium increased length, abnormal WT + MO1-grk5l standard conditions Fig. 3 with image from Burkhalter et al., 2013
heart looping decreased process quality, abnormal WT + MO1-grk5l standard conditions Fig. 1 with imageFig. 3 with image from Burkhalter et al., 2013
heart malformed, abnormal WT + MO1-grk5 + MO1-grk5l standard conditions Fig. S1 with image from Burkhalter et al., 2013
heart looping decreased process quality, abnormal WT + MO1-grk5 + MO1-grk5l standard conditions Fig. S1 with image from Burkhalter et al., 2013
Citations