ZFIN ID: ZDB-MRPHLNO-110609-3
Morpholino Name: MO1-cdk5rap3
Target: cdk5rap3 (1)
Previous Names: lzap-5'-UTR MO (1), MO1-cdkrap3 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - AAGAATTACTAAAACGACCCCATGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO. Targets the 5'UTR.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-cdk5rap3 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-cdk5rap3
Expressed Gene Anatomy Figures
bmp2b Fig. 5 with image from Liu et al., 2011
ctslb Fig. 5 with image from Liu et al., 2011
eve1 Fig. 5 with image from Liu et al., 2011
tbxta Fig. 5 with image from Liu et al., 2011
PHENOTYPE
Phenotype resulting from MO1-cdk5rap3
Phenotype Figures
blastoderm cell cellular adhesivity blastoderm cell, abnormal Fig. 4 with image from Liu et al., 2011
blastoderm cell decreased amount, abnormal Fig. 4 with image from Liu et al., 2011
blastoderm cell increased size, abnormal Fig. 4 with image from Liu et al., 2011
blastoderm cell nucleus decreased amount, abnormal Fig. S3 with image from Liu et al., 2011
blastoderm cell nucleus increased size, abnormal Fig. S3 with image from Liu et al., 2011
cell population proliferation decreased occurrence, abnormal Fig. 4 with image from Liu et al., 2011
embryo development arrested, abnormal Fig. 3 with imageFig. 4 with image from Liu et al., 2011
embryonic cleavage arrested, abnormal Fig. 3 with imageFig. 4 with image from Liu et al., 2011
embryonic cleavage delayed, abnormal Fig. 3 with image from Liu et al., 2011
epiboly involved in gastrulation with mouth forming second arrested, abnormal Fig. 4 with image from Liu et al., 2011
epiboly involved in gastrulation with mouth forming second decreased rate, abnormal Fig. 3 with image from Liu et al., 2011
G2/M transition of mitotic cell cycle delayed, abnormal Fig. 5 with image from Liu et al., 2011
gastrulation decreased rate, abnormal Fig. 3 with imageFig. 4 with image from Liu et al., 2011
intrinsic apoptotic signaling pathway increased process quality, abnormal Fig. 4 with image from Liu et al., 2011
mitotic cell cycle decreased occurrence, abnormal Fig. 4 with image from Liu et al., 2011
mitotic cell cycle delayed, abnormal Fig. 5 with image from Liu et al., 2011
whole organism apoptotic, abnormal Fig. 4 with image from Liu et al., 2011
whole organism hypoplastic, abnormal Fig. 3 with imageFig. 4 with image from Liu et al., 2011
whole organism morphology, abnormal Fig. 3 with imageFig. 4 with image from Liu et al., 2011
whole organism viability, abnormal Fig. 3 with image from Liu et al., 2011
whole organism anterior-posterior axis decreased length, abnormal Fig. 3 with imageFig. 4 with image from Liu et al., 2011

Phenotype of all Fish created by or utilizing MO1-cdk5rap3
Phenotype Fish Conditions Figures
blastoderm cell increased size, abnormal AB + MO1-cdk5rap3 standard conditions Fig. 4 with image from Liu et al., 2011
embryonic cleavage delayed, abnormal AB + MO1-cdk5rap3 standard conditions Fig. 3 with image from Liu et al., 2011
mitotic cell cycle delayed, abnormal AB + MO1-cdk5rap3 standard conditions Fig. 5 with image from Liu et al., 2011
whole organism hypoplastic, abnormal AB + MO1-cdk5rap3 standard conditions Fig. 3 with imageFig. 4 with image from Liu et al., 2011
epiboly involved in gastrulation with mouth forming second arrested, abnormal AB + MO1-cdk5rap3 standard conditions Fig. 4 with image from Liu et al., 2011
blastoderm cell nucleus decreased amount, abnormal AB + MO1-cdk5rap3 standard conditions Fig. S3 with image from Liu et al., 2011
blastoderm cell decreased amount, abnormal AB + MO1-cdk5rap3 standard conditions Fig. 4 with image from Liu et al., 2011
embryo development arrested, abnormal AB + MO1-cdk5rap3 standard conditions Fig. 3 with imageFig. 4 with image from Liu et al., 2011
gastrulation decreased rate, abnormal AB + MO1-cdk5rap3 standard conditions Fig. 3 with imageFig. 4 with image from Liu et al., 2011
cell population proliferation decreased occurrence, abnormal AB + MO1-cdk5rap3 standard conditions Fig. 4 with image from Liu et al., 2011
intrinsic apoptotic signaling pathway increased process quality, abnormal AB + MO1-cdk5rap3 standard conditions Fig. 4 with image from Liu et al., 2011
whole organism viability, abnormal AB + MO1-cdk5rap3 standard conditions Fig. 3 with image from Liu et al., 2011
blastoderm cell cellular adhesivity blastoderm cell, abnormal AB + MO1-cdk5rap3 standard conditions Fig. 4 with image from Liu et al., 2011
G2/M transition of mitotic cell cycle delayed, abnormal AB + MO1-cdk5rap3 standard conditions Fig. 5 with image from Liu et al., 2011
whole organism anterior-posterior axis decreased length, abnormal AB + MO1-cdk5rap3 standard conditions Fig. 3 with imageFig. 4 with image from Liu et al., 2011
whole organism apoptotic, abnormal AB + MO1-cdk5rap3 standard conditions Fig. 4 with image from Liu et al., 2011
epiboly involved in gastrulation with mouth forming second decreased rate, abnormal AB + MO1-cdk5rap3 standard conditions Fig. 3 with image from Liu et al., 2011
embryonic cleavage arrested, abnormal AB + MO1-cdk5rap3 standard conditions Fig. 3 with imageFig. 4 with image from Liu et al., 2011
mitotic cell cycle decreased occurrence, abnormal AB + MO1-cdk5rap3 standard conditions Fig. 4 with image from Liu et al., 2011
blastoderm cell nucleus increased size, abnormal AB + MO1-cdk5rap3 standard conditions Fig. S3 with image from Liu et al., 2011
whole organism morphology, abnormal AB + MO1-cdk5rap3 standard conditions Fig. 3 with imageFig. 4 with image from Liu et al., 2011
Genome Resources:
CITATIONS (3)