Morpholino
MO1-ccdc39
- ID
- ZDB-MRPHLNO-110606-1
- Name
- MO1-ccdc39
- Previous Names
-
- ccdc39 sb-MO (1)
- Target
- Sequence
-
5' - TGAGTAGAAGCCAAACTGACTTTGA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ccdc39
| Expressed Gene | Anatomy | Figures |
|---|---|---|
| spaw |
|
Fig. 2
from Merveille et al., 2011 |
Phenotype
Phenotype resulting from MO1-ccdc39
| Phenotype | Fish | Figures |
|---|---|---|
| heart looping process quality, abnormal | WT + MO1-ccdc39 |
Fig. 2
from Merveille et al., 2011 |
Phenotype of all Fish created by or utilizing MO1-ccdc39
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| heart looping process quality, abnormal | WT + MO1-ccdc39 | standard conditions |
Fig. 2
from Merveille et al., 2011 |
Citations
- Niederriter, A.R., Davis, E.E., Golzio, C., Oh, E.C., Tsai, I.C., and Katsanis, N. (2013) In Vivo Modeling of the Morbid Human Genome using Danio rerio. Journal of visualized experiments : JoVE. (78):e50338
- Merveille, A.C., Davis, E.E., Becker-Heck, A., Legendre, M., Amirav, I., Bataille, G., Belmont, J., Beydon, N., Billen, F., Clément, A., Clercx, C., Coste, A., Crosbie, R., de Blic, J., Deleuze, S., Duquesnoy, P., Escalier, D., Escudier, E., Fliegauf, M., Horvath, J., Hill, K., Jorissen, M., Just, J., Kispert, A., Lathrop, M., Loges, N.T., Marthin, J.K., Momozawa, Y., Montantin, G., Nielsen, K.G., Olbrich, H., Papon, J.F., Rayet, I., Roger, G., Schmidts, M., Tenreiro, H., Towbin, J.A., Zelenika, D., Zentgraf, H., Georges, M., Lequarré, A.S., Katsanis, N., Omran, H., and Amselem, S. (2011) CCDC39 is required for assembly of inner dynein arms and the dynein regulatory complex and for normal ciliary motility in humans and dogs. Nature Genetics. 43(1):72-78
1 - 2 of 2
Show