ZFIN ID: ZDB-MRPHLNO-110525-3
Morpholino Name: MO2-adrb2b
Target: adrb2b (1)
Previous Name: beta2bAR MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GATCAGCGTATTGTCTCCCTCCATG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-adrb2b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-adrb2b No data available
PHENOTYPE
Phenotype resulting from MO2-adrb2b
Phenotype Figures
heart contraction increased rate, abnormal text only from Steele et al., 2011
pericardial cavity increased size, abnormal text only from Steele et al., 2011
whole organism curled, abnormal text only from Steele et al., 2011

Phenotype of all Fish created by or utilizing MO2-adrb2b
Phenotype Fish Conditions Figures
pericardial cavity increased size, abnormal WT + MO2-adrb2b standard conditions text only from Steele et al., 2011
whole organism curled, abnormal WT + MO2-adrb2b standard conditions text only from Steele et al., 2011
heart contraction increased rate, abnormal WT + MO2-adrb2b standard conditions text only from Steele et al., 2011
heart contraction increased rate, abnormal WT + MO1-adrb2a + MO2-adrb2b standard conditions text only from Steele et al., 2011
OTHER MO2-adrb2b MORPHOLINO PAGESNo links to external sites
CITATIONS (2)