Morpholino

MO1-nav3

ID
ZDB-MRPHLNO-110519-1
Name
MO1-nav3
Previous Names
  • nav3a ATG morpholino (1)
Target
Sequence
5' - TTGAAGCAACACCAACTACCGGCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-nav3
No data available
Phenotype
Phenotype resulting from MO1-nav3
Phenotype Fish Figures
cell migration disrupted, abnormal s870Tg + MO1-nav3 Fig. 3 with image from Klein et al., 2011
cerebellum decreased size, abnormal nl1Tg + MO1-nav3 Fig. 5 with image from Ghaffar et al., 2024
eye hypoplastic, abnormal nl1Tg + MO1-nav3 Fig. 5 with image from Ghaffar et al., 2024
habenula decreased size, abnormal nl1Tg + MO1-nav3 Fig. 5 with image from Ghaffar et al., 2024
head decreased size, abnormal nl1Tg + MO1-nav3 Fig. 5 with image from Ghaffar et al., 2024
head hypoplastic, abnormal nl1Tg + MO1-nav3 Fig. 5 with image from Ghaffar et al., 2024
liver aplastic, abnormal s870Tg + MO1-nav3 Fig. 2 with image,  Fig. 5 with image from Klein et al., 2011
liver decreased size, abnormal s870Tg + MO1-nav3 Fig. 2 with image from Klein et al., 2011
liver shape, abnormal s870Tg + MO1-nav3 Fig. 2 with image from Klein et al., 2011
liver development disrupted, abnormal s870Tg + MO1-nav3 Fig. 2 with image,  Fig. 3 with image,  Fig. 5 with image from Klein et al., 2011
liver primordium decreased size, abnormal s870Tg + MO1-nav3 Fig. 3 with image from Klein et al., 2011
optic tectum decreased area, abnormal nl1Tg + MO1-nav3 Fig. 5 with image from Ghaffar et al., 2024
pancreas development disrupted, abnormal s870Tg + MO1-nav3 Fig. 5 with image from Klein et al., 2011
pericardium edematous, abnormal nl1Tg + MO1-nav3 Fig. 5 with image from Ghaffar et al., 2024
post-vent region curved, abnormal nl1Tg + MO1-nav3 Fig. 5 with image from Ghaffar et al., 2024
swim bladder development disrupted, abnormal s870Tg + MO1-nav3 Fig. 5 with image from Klein et al., 2011
swimming behavior decreased process quality, abnormal nl1Tg + MO1-nav3 Fig. 5 with image from Ghaffar et al., 2024
torus longitudinalis absence of anatomical entity, abnormal nl1Tg + MO1-nav3 Fig. 5 with image from Ghaffar et al., 2024
whole organism decreased length, abnormal nl1Tg + MO1-nav3 Fig. 5 with image from Ghaffar et al., 2024
yolk edematous, abnormal nl1Tg + MO1-nav3 Fig. 5 with image from Ghaffar et al., 2024
Phenotype of all Fish created by or utilizing MO1-nav3
Phenotype Fish Conditions Figures
pericardium edematous, abnormal nl1Tg + MO1-nav3 standard conditions Fig. 5 with image from Ghaffar et al., 2024
torus longitudinalis absence of anatomical entity, abnormal nl1Tg + MO1-nav3 standard conditions Fig. 5 with image from Ghaffar et al., 2024
whole organism decreased length, abnormal nl1Tg + MO1-nav3 standard conditions Fig. 5 with image from Ghaffar et al., 2024
optic tectum decreased area, abnormal nl1Tg + MO1-nav3 standard conditions Fig. 5 with image from Ghaffar et al., 2024
habenula decreased size, abnormal nl1Tg + MO1-nav3 standard conditions Fig. 5 with image from Ghaffar et al., 2024
swimming behavior decreased process quality, abnormal nl1Tg + MO1-nav3 standard conditions Fig. 5 with image from Ghaffar et al., 2024
cerebellum decreased size, abnormal nl1Tg + MO1-nav3 standard conditions Fig. 5 with image from Ghaffar et al., 2024
post-vent region curved, abnormal nl1Tg + MO1-nav3 standard conditions Fig. 5 with image from Ghaffar et al., 2024
head hypoplastic, abnormal nl1Tg + MO1-nav3 standard conditions Fig. 5 with image from Ghaffar et al., 2024
head decreased size, abnormal nl1Tg + MO1-nav3 standard conditions Fig. 5 with image from Ghaffar et al., 2024
yolk edematous, abnormal nl1Tg + MO1-nav3 standard conditions Fig. 5 with image from Ghaffar et al., 2024
eye hypoplastic, abnormal nl1Tg + MO1-nav3 standard conditions Fig. 5 with image from Ghaffar et al., 2024
liver primordium decreased size, abnormal s870Tg + MO1-nav3 standard conditions Fig. 3 with image from Klein et al., 2011
liver shape, abnormal s870Tg + MO1-nav3 standard conditions Fig. 2 with image from Klein et al., 2011
pancreas development disrupted, abnormal s870Tg + MO1-nav3 standard conditions Fig. 5 with image from Klein et al., 2011
swim bladder development disrupted, abnormal s870Tg + MO1-nav3 standard conditions Fig. 5 with image from Klein et al., 2011
liver decreased size, abnormal s870Tg + MO1-nav3 standard conditions Fig. 2 with image from Klein et al., 2011
liver development disrupted, abnormal s870Tg + MO1-nav3 standard conditions Fig. 2 with image,  Fig. 3 with image,  Fig. 5 with image from Klein et al., 2011
cell migration disrupted, abnormal s870Tg + MO1-nav3 standard conditions Fig. 3 with image from Klein et al., 2011
liver aplastic, abnormal s870Tg + MO1-nav3 standard conditions Fig. 2 with image,  Fig. 5 with image from Klein et al., 2011
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.