Morpholino
MO1-oprm1
- ID
- ZDB-MRPHLNO-110509-2
- Name
- MO1-oprm1
- Previous Names
- None
- Target
- Sequence
-
5' - AATGTTGCCAGTGTTTTCCATCATG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-oprm1
No data available
Phenotype
Phenotype resulting from MO1-oprm1
1 - 5 of 10 Show all
Phenotype of all Fish created by or utilizing MO1-oprm1
1 - 5 of 11 Show all
Citations
- Arévalo, J.C., Hernández-Jiménez, E., Jiménez-González, A., Torres-Valle, M., Iwasaki, R.S., López-Bellido, R., Vicente-García, C., Rodríguez, R.E. (2018) Generation and Characterization of Antibodies against Opioid Receptors from Zebrafish. International Journal of Molecular Sciences. 19(1)
- Garcia-Concejo, A., Jimenez-Gonzalez, A., Rodríguez, R.E. (2016) μ Opioid Receptor Expression after Morphine Administration Is Regulated by miR-212/132 Cluster. PLoS One. 11:e0157806
- Jimenez-Gonzalez, A., García-Concejo, A., López-Benito, S., Gonzalez-Nunez, V., Arévalo, J.C., Rodriguez, R.E. (2016) Role of morphine, miR-212/132 and mu opioid receptor in the regulation of bdnf in zebrafish embryos. Biochimica et biophysica acta. General subjects. 1860(6):1308-16
- Herrero-Turrión, M.J., Rodríguez-Martín, I., López-Bellido, R., Rodríguez, R.E. (2014) Whole-genome expression profile in zebrafish embryos after chronic exposure to morphine: identification of new genes associated with neuronal function and mu opioid receptor expression. BMC Genomics. 15:874
- Gonzalez-Nunez, V., González, A.J., Barreto-Valer, K., and Rodríguez, R.E. (2013) In vivo regulation of the mu opioid receptor. Role of the endogenous opioid agents. Molecular medicine (Cambridge, Mass.). 19:7-17
- López-Bellido, R., Barreto-Valer, K., and Rodríguez, R.E. (2013) Substance P mRNA expression during zebrafish development: Influence of mu opioid receptor and cocaine. Neuroscience. 242:53-68
- López-Bellido, R., Barreto-Valer, K., and Rodriguez, R.E. (2013) Expression of tachykinin receptors in zebrafish: influence of cocaine and opioid receptors. Journal of molecular endocrinology. 50(2):115-129
- López-Bellido, R., Barreto-Valer, K., Sánchez-Simón, F.M., and Rodríguez, R.E. (2012) Cocaine Modulates the Expression of Opioid Receptors and miR-let-7d in Zebrafish Embryos. PLoS One. 7(11):e50885
- Sanchez-Simon, F.M., Zhang, X.X., Loh, H.H., Law, P.Y., and Rodriguez, R.E. (2010) Morphine regulates dopaminergic neuron differentiation via miR-133b. Molecular pharmacology. 78(5):935-942
1 - 9 of 9
Show