Community Action Needed: Please respond to the NIH RFI
Morpholino

MO4-nr3c1

ID
ZDB-MRPHLNO-110325-5
Name
MO4-nr3c1
Previous Names
  • grsplicMO (1)
Target
Sequence
5' - GCCAGAGATATATGGAATACCTTCA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
View all 3 target locations
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-nr3c1
Phenotype
Phenotype resulting from MO4-nr3c1
Phenotype of all Fish created by or utilizing MO4-nr3c1
Phenotype Fish Conditions Figures
ethmoid cartilage retracted, abnormal WT + MO4-nr3c1 standard conditions Fig. 5 with image from Pikulkaew et al., 2011
ceratohyal cartilage fused with hypobranchial cartilage, abnormal WT + MO4-nr3c1 standard conditions Fig. 5 with image from Pikulkaew et al., 2011
ethmoid cartilage curled, abnormal WT + MO4-nr3c1 standard conditions Fig. 5 with image from Pikulkaew et al., 2011
head epidermis irg1l expression mislocalised, abnormal WT + MO4-nr3c1 bacterial treatment by injection: Salmonella enterica subsp. enterica serovar Typhimurium Fig. 3 from Hall et al., 2014
whole organism egln3 expression amount, ameliorated WT + MO4-nr3c1 chemical treatment: dexamethasone Fig. 3 with image from Vettori et al., 2017
Meckel's cartilage disoriented, abnormal WT + MO4-nr3c1 standard conditions Fig. 5 with image from Pikulkaew et al., 2011
macrophage acod1 expression amount, ameliorated WT + MO4-nr3c1 bacterial treatment by injection: Salmonella enterica subsp. enterica serovar Typhimurium Fig. 3 with image from Hall et al., 2013
epithelial cell irg1l expression mislocalised, abnormal WT + MO4-nr3c1 bacterial treatment by injection: Salmonella enterica subsp. enterica serovar Typhimurium Fig. 3 from Hall et al., 2014
neuromast epithelium irg1l expression mislocalised, abnormal WT + MO4-nr3c1 bacterial treatment by injection: Salmonella enterica subsp. enterica serovar Typhimurium Fig. 3 from Hall et al., 2014
Meckel's cartilage decreased size, abnormal WT + MO4-nr3c1 standard conditions Fig. 5 with image from Pikulkaew et al., 2011
olfactory epithelium irg1l expression mislocalised, abnormal WT + MO4-nr3c1 bacterial treatment by injection: Salmonella enterica subsp. enterica serovar Typhimurium Fig. 3 from Hall et al., 2014
blood macrophage cebpb expression amount, ameliorated WT + MO4-nr3c1 bacterial treatment by injection: Salmonella enterica subsp. enterica serovar Typhimurium Fig. 3 with image from Hall et al., 2013
ceratohyal cartilage disoriented, abnormal WT + MO4-nr3c1 standard conditions Fig. 5 with image from Pikulkaew et al., 2011
Meckel's cartilage fused with palatoquadrate cartilage, abnormal WT + MO4-nr3c1 standard conditions Fig. 5 with image from Pikulkaew et al., 2011
whole organism EGFP expression amount, ameliorated ia21Tg + MO4-nr3c1 chemical treatment: dexamethasone Fig. 3 with image from Vettori et al., 2017
whole organism fkbp5 expression decreased amount, abnormal ia21Tg + MO4-nr3c1 control Fig. S3 with image from Vettori et al., 2017
macrophage acod1 expression amount, ameliorated WT + MO2-stat3 + MO4-nr3c1 bacterial treatment by injection: Salmonella enterica subsp. enterica serovar Typhimurium Fig. 4 with image from Hall et al., 2013
Citations