Morpholino
MO4-nr3c1
- ID
- ZDB-MRPHLNO-110325-5
- Name
- MO4-nr3c1
- Previous Names
-
- grsplicMO (1)
- Target
- Sequence
-
5' - GCCAGAGATATATGGAATACCTTCA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-nr3c1
No data available
Phenotype
Phenotype resulting from MO4-nr3c1
1 - 5 of 8 Show all
Phenotype of all Fish created by or utilizing MO4-nr3c1
1 - 5 of 17 Show all
Citations
- Vettori, A., Greenald, D., Wilson, G.K., Peron, M., Facchinello, N., Markham, E., Sinnakaruppan, M., Matthews, L.C., McKeating, J.A., Argenton, F., van Eeden, F.J.M. (2017) Glucocorticoids promote Von Hippel Lindau degradation and Hif-1α stabilization. Proceedings of the National Academy of Sciences of the United States of America. 114(37):9948-9953
- Benato, F., Colletti, E., Skobo, T., Moro, E., Colombo, L., Argenton, F., Dalla Valle, L. (2014) A living biosensor model to dynamically trace glucocorticoid transcriptional activity during development and adult life in zebrafish. Molecular and Cellular Endocrinology. 392(1-2):60-72
- Hall, C.J., Boyle, R.H., Sun, X., Wicker, S.M., Misa, J.P., Krissansen, G.W., Print, C.G., Crosier, K.E., Crosier, P.S. (2014) Epidermal cells help coordinate leukocyte migration during inflammation through fatty acid-fuelled matrix metalloproteinase production. Nature communications. 5:3880
- Hall, C.J., Boyle, R.H., Astin, J.W., Flores, M.V., Oehlers, S.H., Sanderson, L.E., Ellett, F., Lieschke, G.J., Crosier, K.E., and Crosier, P.S. (2013) Immunoresponsive Gene 1 Augments Bactericidal Activity of Macrophage-Lineage Cells by Regulating β-Oxidation-Dependent Mitochondrial ROS Production. Cell Metabolism. 18(2):265-278
- Pikulkaew, S., Benato, F., Celeghin, A., Zucal, C., Skobo, T., Colombo, L., and Dalla Valle , L. (2011) The knockdown of maternal glucocorticoid receptor mRNA alters embryo development in zebrafish. Developmental Dynamics : an official publication of the American Association of Anatomists. 240(4):874-889
1 - 5 of 5
Show