Morpholino

MO1-gbx2

ID
ZDB-MRPHLNO-110324-1
Name
MO1-gbx2
Previous Names
None
Target
Sequence
5' - ACGGTGTGCTGAAAGCTGCACTCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-gbx2
No data available
Phenotype
Phenotype resulting from MO1-gbx2
Phenotype Fish Figures
apoptotic process increased occurrence, abnormal ba2Tg + MO1-gbx2 Fig. 3 from Hozumi et al., 2018
cell proliferation in forebrain decreased occurrence, abnormal rw0Tg + MO1-gbx2 Fig. 3 with image from Burroughs-Garcia et al., 2011
cell proliferation in hindbrain decreased occurrence, abnormal rw0Tg + MO1-gbx2 Fig. 3 with image from Burroughs-Garcia et al., 2011
cranial nerve V motor neuron disorganized, abnormal rw0Tg + MO1-gbx2 Fig. 1 with imageFig. 4 with image from Burroughs-Garcia et al., 2011
cranial nerve V neuronal cell body position, abnormal rw0Tg + MO1-gbx2 Fig. 5 with image from Burroughs-Garcia et al., 2011
hindbrain anterior region truncated, abnormal WT + MO1-gbx2 Fig. 1 with imageFig. 4 with image from Burroughs-Garcia et al., 2011
hindbrain development disrupted, abnormal rw0Tg + MO1-gbx2 Fig. 1 with image from Burroughs-Garcia et al., 2011
iridoblast ltk expression absent, abnormal WT + MO1-gbx2 Fig. 3 from Hozumi et al., 2018
iridophore pnp4a expression absent, abnormal WT + MO1-gbx2 Fig. 3 from Hozumi et al., 2018
rhombomere 2 apoptotic, abnormal WT + MO1-gbx2 Fig. 4 with image from Burroughs-Garcia et al., 2011
rhombomere 3 apoptotic, abnormal WT + MO1-gbx2 Fig. 4 with image from Burroughs-Garcia et al., 2011
rhombomere 3 decreased width, abnormal rw0Tg + MO1-gbx2 Fig. 1 with image from Burroughs-Garcia et al., 2011
rhombomere 4 apoptotic, abnormal WT + MO1-gbx2 Fig. 4 with image from Burroughs-Garcia et al., 2011
rhombomere 5 apoptotic, abnormal WT + MO1-gbx2 Fig. 4 with image from Burroughs-Garcia et al., 2011
whole organism has fewer parts of type iridophore, abnormal WT + MO1-gbx2 Fig. 1 from Hozumi et al., 2018
Phenotype of all Fish created by or utilizing MO1-gbx2
Phenotype Fish Conditions Figures
rhombomere 3 apoptotic, abnormal WT + MO1-gbx2 standard conditions Fig. 4 with image from Burroughs-Garcia et al., 2011
hindbrain anterior region truncated, abnormal WT + MO1-gbx2 standard conditions Fig. 4 with image from Burroughs-Garcia et al., 2011
iridoblast ltk expression absent, abnormal WT + MO1-gbx2 standard conditions Fig. 3 from Hozumi et al., 2018
iridophore pnp4a expression absent, abnormal WT + MO1-gbx2 standard conditions Fig. 3 from Hozumi et al., 2018
rhombomere 2 apoptotic, abnormal WT + MO1-gbx2 standard conditions Fig. 4 with image from Burroughs-Garcia et al., 2011
rhombomere 5 apoptotic, abnormal WT + MO1-gbx2 standard conditions Fig. 4 with image from Burroughs-Garcia et al., 2011
rhombomere 4 apoptotic, abnormal WT + MO1-gbx2 standard conditions Fig. 4 with image from Burroughs-Garcia et al., 2011
whole organism has fewer parts of type iridophore, abnormal WT + MO1-gbx2 standard conditions Fig. 1 from Hozumi et al., 2018
apoptotic process increased occurrence, abnormal ba2Tg + MO1-gbx2 standard conditions Fig. 3 from Hozumi et al., 2018
hindbrain development disrupted, abnormal rw0Tg + MO1-gbx2 standard conditions Fig. 1 with image from Burroughs-Garcia et al., 2011
hindbrain anterior region truncated, abnormal rw0Tg + MO1-gbx2 standard conditions Fig. 1 with image from Burroughs-Garcia et al., 2011
cranial nerve V neuronal cell body position, abnormal rw0Tg + MO1-gbx2 standard conditions Fig. 5 with image from Burroughs-Garcia et al., 2011
cell proliferation in hindbrain decreased occurrence, abnormal rw0Tg + MO1-gbx2 standard conditions Fig. 3 with image from Burroughs-Garcia et al., 2011
cranial nerve V motor neuron disorganized, abnormal rw0Tg + MO1-gbx2 standard conditions Fig. 1 with imageFig. 4 with image from Burroughs-Garcia et al., 2011
rhombomere 3 decreased width, abnormal rw0Tg + MO1-gbx2 standard conditions Fig. 1 with image from Burroughs-Garcia et al., 2011
cell proliferation in forebrain decreased occurrence, abnormal rw0Tg + MO1-gbx2 standard conditions Fig. 3 with image from Burroughs-Garcia et al., 2011
Citations