header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-110324-1
Morpholino Name: MO1-gbx2
Target: gbx2 (1)
Sequence:
5' - ACGGTGTGCTGAAAGCTGCACTCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-gbx2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-gbx2
Expressed Gene Anatomy Figures
aox5 Fig. 3 from Hozumi et al., 2018
dct Fig. 3 from Hozumi et al., 2018
foxd3 Fig. 3 from Hozumi et al., 2018
gbx1 Fig. 2 with image from Burroughs-Garcia et al., 2011
hoxa2b Fig. 1 with image from Burroughs-Garcia et al., 2011
ltk Fig. 3 from Hozumi et al., 2018
mitfa Fig. 3 from Hozumi et al., 2018
pnp4a Fig. 3 from Hozumi et al., 2018
PHENOTYPE
Phenotype resulting from MO1-gbx2
Phenotype of all Fish created by or utilizing MO1-gbx2
Phenotype Fish Conditions Figures
rhombomere 3 apoptotic, abnormal WT + MO1-gbx2 standard conditions Fig. 4 with image from Burroughs-Garcia et al., 2011
hindbrain anterior region truncated, abnormal WT + MO1-gbx2 standard conditions Fig. 4 with image from Burroughs-Garcia et al., 2011
iridoblast ltk expression absent, abnormal WT + MO1-gbx2 standard conditions Fig. 3 from Hozumi et al., 2018
iridophore pnp4a expression absent, abnormal WT + MO1-gbx2 standard conditions Fig. 3 from Hozumi et al., 2018
rhombomere 2 apoptotic, abnormal WT + MO1-gbx2 standard conditions Fig. 4 with image from Burroughs-Garcia et al., 2011
rhombomere 5 apoptotic, abnormal WT + MO1-gbx2 standard conditions Fig. 4 with image from Burroughs-Garcia et al., 2011
rhombomere 4 apoptotic, abnormal WT + MO1-gbx2 standard conditions Fig. 4 with image from Burroughs-Garcia et al., 2011
whole organism has fewer parts of type iridophore, abnormal WT + MO1-gbx2 standard conditions Fig. 1 from Hozumi et al., 2018
apoptotic process increased occurrence, abnormal ba2Tg + MO1-gbx2 standard conditions Fig. 3 from Hozumi et al., 2018
hindbrain development disrupted, abnormal rw0Tg + MO1-gbx2 standard conditions Fig. 1 with image from Burroughs-Garcia et al., 2011
hindbrain anterior region truncated, abnormal rw0Tg + MO1-gbx2 standard conditions Fig. 1 with image from Burroughs-Garcia et al., 2011
cranial nerve V neuronal cell body position, abnormal rw0Tg + MO1-gbx2 standard conditions Fig. 5 with image from Burroughs-Garcia et al., 2011
cell proliferation in hindbrain decreased occurrence, abnormal rw0Tg + MO1-gbx2 standard conditions Fig. 3 with image from Burroughs-Garcia et al., 2011
cranial nerve V motor neuron disorganized, abnormal rw0Tg + MO1-gbx2 standard conditions Fig. 1 with imageFig. 4 with image from Burroughs-Garcia et al., 2011
rhombomere 3 decreased width, abnormal rw0Tg + MO1-gbx2 standard conditions Fig. 1 with image from Burroughs-Garcia et al., 2011
cell proliferation in forebrain decreased occurrence, abnormal rw0Tg + MO1-gbx2 standard conditions Fig. 3 with image from Burroughs-Garcia et al., 2011
OTHER MO1-gbx2 MORPHOLINO PAGES No links to external sites
CITATIONS (4)