Morpholino
MO1-rab3ip
- ID
- ZDB-MRPHLNO-110323-1
- Name
- MO1-rab3ip
- Previous Names
-
- Rabin8 MO (1)
- MO1-zgc:110270
- Target
- Sequence
-
5' - TCTTCATACAGCACTCTGAGAAAAC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-rab3ip
No data available
Phenotype
Phenotype resulting from MO1-rab3ip
1 - 2 of 2
Phenotype of all Fish created by or utilizing MO1-rab3ip
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| melanosome transport decreased rate, abnormal | WT + MO1-rab3ip | standard conditions |
Fig. S3 
from Westlake et al., 2011 |
| Kupffer's vesicle morphology, abnormal | WT + MO1-rab3ip | standard conditions |
Fig. 3
from Westlake et al., 2011 |
1 - 2 of 2
Citations
- Saha, I., Insinna, C., Westlake, C.J. (2024) Rab11-Rab8 cascade dynamics in primary cilia and membrane tubules. Cell Reports. 43:114955114955
- Westlake, C.J., Baye, L.M., Nachury, M.V., Wright, K.J., Ervin, K.E., Phu, L., Chalouni, C., Beck, J.S., Kirkpatrick, D.S., Slusarski, D.C., Sheffield, V.C., Scheller, R.H., and Jackson, P.K. (2011) Primary cilia membrane assembly is initiated by Rab11 and transport protein particle II (TRAPPII) complex-dependent trafficking of Rabin8 to the centrosome. Proceedings of the National Academy of Sciences of the United States of America. 108(7):2759-2764
1 - 2 of 2
Show